EMAIL THIS PAGE TO A FRIEND

DHFRL1

dihydrofolate reductase-like 1

Synonyms: DHFRP4
Species: Human DHFRL1(200895)
UniProtKB ID: Q86XF0, D3DN30, Q6P4I9
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176815 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108971 MISSION® esiRNA esiRNA human DHFRL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176815 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028632 predicted 279
2 SASI_Hs01_00028631 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176815
DHFRL1 MISSION shRNA Bacterial Glycerol Stock
dihydrofolate reductase-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176815.2-2273s1c1
Sequence:CCGGGCCCTGTCTCTACAGAAGATACTCGAGTATCTTCTGTAGAGACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-287s1c1
Sequence:CCGGCAACTTCTTCAGTAGAGGGTACTCGAGTACCCTCTACTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-552s1c1
Sequence:CCGGCCTAGGCCATCTTAAACTATTCTCGAGAATAGTTTAAGATGGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-472s1c1
Sequence:CCGGGAACGACCAGAATTAGCAAATCTCGAGATTTGCTAATTCTGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-2895s1c1
Sequence:CCGGGCATTTAGAAAGAAGTGCATTCTCGAGAATGCACTTCTTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-709s1c1
Sequence:CCGGGAAGTATGTGAGAAGGATGATCTCGAGATCATCCTTCTCACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-475s1c1
Sequence:CCGGCGACCAGAATTAGCAAATAAACTCGAGTTTATTTGCTAATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-1269s1c1
Sequence:CCGGGCAGTTTATTTGCTAGGTCATCTCGAGATGACCTAGCAAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-443s1c1
Sequence:CCGGGAAGTTTGGATGATGCCTTAACTCGAGTTAAGGCATCATCCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-496s1c1
Sequence:CCGGGTAGACATGATTTGGATAGTTCTCGAGAACTATCCAAATCATGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-862s1c1
Sequence:CCGGCCTCACTAATCTTGGCTATATCTCGAGATATAGCCAAGATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-352s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176815
DHFRL1 MISSION shRNA shRNA Plasmid DNA
dihydrofolate reductase-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176815.2-2273s1c1
Sequence:CCGGGCCCTGTCTCTACAGAAGATACTCGAGTATCTTCTGTAGAGACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-287s1c1
Sequence:CCGGCAACTTCTTCAGTAGAGGGTACTCGAGTACCCTCTACTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-552s1c1
Sequence:CCGGCCTAGGCCATCTTAAACTATTCTCGAGAATAGTTTAAGATGGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-472s1c1
Sequence:CCGGGAACGACCAGAATTAGCAAATCTCGAGATTTGCTAATTCTGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-2895s1c1
Sequence:CCGGGCATTTAGAAAGAAGTGCATTCTCGAGAATGCACTTCTTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-709s1c1
Sequence:CCGGGAAGTATGTGAGAAGGATGATCTCGAGATCATCCTTCTCACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-475s1c1
Sequence:CCGGCGACCAGAATTAGCAAATAAACTCGAGTTTATTTGCTAATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-1269s1c1
Sequence:CCGGGCAGTTTATTTGCTAGGTCATCTCGAGATGACCTAGCAAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-443s1c1
Sequence:CCGGGAAGTTTGGATGATGCCTTAACTCGAGTTAAGGCATCATCCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-496s1c1
Sequence:CCGGGTAGACATGATTTGGATAGTTCTCGAGAACTATCCAAATCATGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-862s1c1
Sequence:CCGGCCTCACTAATCTTGGCTATATCTCGAGATATAGCCAAGATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-352s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176815
DHFRL1 MISSION shRNA Lentiviral Transduction Particles
dihydrofolate reductase-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165880    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176815.2-2273s1c1
Sequence:CCGGGCCCTGTCTCTACAGAAGATACTCGAGTATCTTCTGTAGAGACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-287s1c1
Sequence:CCGGCAACTTCTTCAGTAGAGGGTACTCGAGTACCCTCTACTGAAGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-552s1c1
Sequence:CCGGCCTAGGCCATCTTAAACTATTCTCGAGAATAGTTTAAGATGGCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-472s1c1
Sequence:CCGGGAACGACCAGAATTAGCAAATCTCGAGATTTGCTAATTCTGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-2895s1c1
Sequence:CCGGGCATTTAGAAAGAAGTGCATTCTCGAGAATGCACTTCTTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-709s1c1
Sequence:CCGGGAAGTATGTGAGAAGGATGATCTCGAGATCATCCTTCTCACATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-475s1c1
Sequence:CCGGCGACCAGAATTAGCAAATAAACTCGAGTTTATTTGCTAATTCTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-1269s1c1
Sequence:CCGGGCAGTTTATTTGCTAGGTCATCTCGAGATGACCTAGCAAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-443s1c1
Sequence:CCGGGAAGTTTGGATGATGCCTTAACTCGAGTTAAGGCATCATCCAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176815.2-496s1c1
Sequence:CCGGGTAGACATGATTTGGATAGTTCTCGAGAACTATCCAAATCATGTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176815.2-862s1c1
Sequence:CCGGCCTCACTAATCTTGGCTATATCTCGAGATATAGCCAAGATTAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176815.2-352s1c1
Sequence:CCGGCCTGAGAAGAATCGACCTTTACTCGAGTAAAGGTCGATTCTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks