EMAIL THIS PAGE TO A FRIEND

DHH

desert hedgehog

74 Gene Product Result for
Synonyms: GDXYM HHG-3 SRXY7
UniProtKB ID: O43323, Q15794
Gene ID:
Human(50846) Summary: This gene encodes a member of the hedgehog family. The hedgehog gene family encodes signaling molecules that play an important role in regulating morphogenesis. This protein is predicted to be made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the organism. Defects in this protein have been associated with partial gonadal dysgenesis (PGD) accompanied by minifascicular polyneuropathy. This protein may be involved in both male gonadal differentiation and perineurial development. [provided by RefSeq, May 2010]
Mouse(13363) desert hedgehog
Rat(84380) desert hedgehog
Zebrafish(558147) desert hedgehog
dog(100685337) desert hedgehog
cow(525833) desert hedgehog
domestic cat(101095751) desert hedgehog
naked mole-rat(101717728) desert hedgehog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021044 Rosetta Predictions human pricing
XM_001062733 Rosetta Predictions rat pricing
XM_343327 Rosetta Predictions rat pricing
NM_007857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192478 predicted 739
2 SASI_Hs02_00354514 predicted 637
3 SASI_Hs01_00192480 predicted 706
4 SASI_Hs01_00192481 predicted 1040
5 SASI_Hs01_00192482 predicted 920
6 SASI_Hs01_00192483 predicted 593
7 SASI_Hs01_00192484 predicted 1037
8 SASI_Hs02_00354515 predicted 1324
9 SASI_Hs01_00192485 predicted 714
10 SASI_Hs01_00192486 predicted 605
11 SASI_Hs01_00192479 predicted 940
12 SASI_Hs01_00192487 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304423 predicted 943
2 SASI_Rn02_00304424 predicted 746
3 SASI_Rn02_00304425 predicted 393
4 SASI_Rn02_00304426 predicted 846
5 SASI_Rn02_00304427 predicted 833
6 SASI_Rn02_00304428 predicted 433
7 SASI_Rn02_00304429 predicted 425
8 SASI_Rn02_00304430 predicted 595
9 SASI_Rn02_00304431 predicted 751
10 SASI_Rn02_00304432 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395643 predicted 1238
2 SASI_Rn02_00395644 predicted 1124
3 SASI_Rn02_00395645 predicted 1259
4 SASI_Rn02_00395646 predicted 1130
5 SASI_Rn02_00395647 predicted 1150
6 SASI_Rn02_00395648 predicted 1134
7 SASI_Rn02_00395649 predicted 1153
8 SASI_Rn02_00395650 predicted 1158
9 SASI_Rn02_00395651 predicted 1122
10 SASI_Rn02_00395652 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121502 predicted 583
2 SASI_Mm02_00312628 predicted 378
3 SASI_Mm01_00121503 predicted 413
4 SASI_Mm01_00121504 predicted 802
5 SASI_Mm01_00121505 predicted 1292
6 SASI_Mm01_00121507 predicted 1940
7 SASI_Mm02_00312629 predicted 670
8 SASI_Mm01_00121508 predicted 713
9 SASI_Mm01_00121509 predicted 383
10 SASI_Mm02_00312630 predicted 399
11 SASI_Mm01_00121500 predicted 381
12 SASI_Mm01_00121501 predicted 1902
13 SASI_Mm01_00121506 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021044
DHH MISSION shRNA Bacterial Glycerol Stock
desert hedgehog
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-610s1c1
Sequence:CCGGGCGTTGTAAGGAGCGGGTGAACTCGAGTTCACCCGCTCCTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-431s1c1
Sequence:CCGGCCGCTACTCTACAAGCAATTTCTCGAGAAATTGCTTGTAGAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-738s1c1
Sequence:CCGGGCCGTGCTTTGGACATCACTACTCGAGTAGTGATGTCCAAAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-712s1c1
Sequence:CCGGCGCTCAGGATTCACTCCACTACTCGAGTAGTGGAGTGAATCCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021044.2-1496s21c1
Sequence:CCGGTGAGCGTCCCAGGCATAGAAACTCGAGTTTCTATGCCTGGGACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1705s21c1
Sequence:CCGGCTCCTTAAAGAGGACTATTTACTCGAGTAAATAGTCCTCTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1651s21c1
Sequence:CCGGCGTACTGAGAGGAGGTGATACCTCGAGGTATCACCTCCTCTCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021044
DHH MISSION shRNA shRNA Plasmid DNA
desert hedgehog
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-610s1c1
Sequence:CCGGGCGTTGTAAGGAGCGGGTGAACTCGAGTTCACCCGCTCCTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-431s1c1
Sequence:CCGGCCGCTACTCTACAAGCAATTTCTCGAGAAATTGCTTGTAGAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-738s1c1
Sequence:CCGGGCCGTGCTTTGGACATCACTACTCGAGTAGTGATGTCCAAAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-712s1c1
Sequence:CCGGCGCTCAGGATTCACTCCACTACTCGAGTAGTGGAGTGAATCCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021044.2-1496s21c1
Sequence:CCGGTGAGCGTCCCAGGCATAGAAACTCGAGTTTCTATGCCTGGGACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1705s21c1
Sequence:CCGGCTCCTTAAAGAGGACTATTTACTCGAGTAAATAGTCCTCTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1651s21c1
Sequence:CCGGCGTACTGAGAGGAGGTGATACCTCGAGGTATCACCTCCTCTCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021044
DHH MISSION shRNA Lentiviral Transduction Particles
desert hedgehog
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-610s1c1
Sequence:CCGGGCGTTGTAAGGAGCGGGTGAACTCGAGTTCACCCGCTCCTTACAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-431s1c1
Sequence:CCGGCCGCTACTCTACAAGCAATTTCTCGAGAAATTGCTTGTAGAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-738s1c1
Sequence:CCGGGCCGTGCTTTGGACATCACTACTCGAGTAGTGATGTCCAAAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021044.2-712s1c1
Sequence:CCGGCGCTCAGGATTCACTCCACTACTCGAGTAGTGGAGTGAATCCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021044.2-1496s21c1
Sequence:CCGGTGAGCGTCCCAGGCATAGAAACTCGAGTTTCTATGCCTGGGACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1705s21c1
Sequence:CCGGCTCCTTAAAGAGGACTATTTACTCGAGTAAATAGTCCTCTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021044.2-1651s21c1
Sequence:CCGGCGTACTGAGAGGAGGTGATACCTCGAGGTATCACCTCCTCTCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007857
VALIDATED
DHH MISSION shRNA Bacterial Glycerol Stock
desert hedgehog
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-734s1c1
Sequence:CCGGCCGTAATAAGTATGGTTTGTTCTCGAGAACAAACCATACTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-810s1c1
Sequence:CCGGCACATCCACGTATCGGTCAAACTCGAGTTTGACCGATACGTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-296s1c1
Sequence:CCGGCCTGTGCTGCTTGGCACTCTTCTCGAGAAGAGTGCCAAGCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-678s1c1
Sequence:CCGGCAGGATTCACTCCACTACGAACTCGAGTTCGTAGTGGAGTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-393s1c1
Sequence:CCGGCCTCTGCTATACAAGCAGTTTCTCGAGAAACTGCTTGTATAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007857
VALIDATED
DHH MISSION shRNA shRNA Plasmid DNA
desert hedgehog
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-734s1c1
Sequence:CCGGCCGTAATAAGTATGGTTTGTTCTCGAGAACAAACCATACTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-810s1c1
Sequence:CCGGCACATCCACGTATCGGTCAAACTCGAGTTTGACCGATACGTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-296s1c1
Sequence:CCGGCCTGTGCTGCTTGGCACTCTTCTCGAGAAGAGTGCCAAGCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-678s1c1
Sequence:CCGGCAGGATTCACTCCACTACGAACTCGAGTTCGTAGTGGAGTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-393s1c1
Sequence:CCGGCCTCTGCTATACAAGCAGTTTCTCGAGAAACTGCTTGTATAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007857
VALIDATED
DHH MISSION shRNA Lentiviral Transduction Particles
desert hedgehog
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-734s1c1
Sequence:CCGGCCGTAATAAGTATGGTTTGTTCTCGAGAACAAACCATACTTATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-810s1c1
Sequence:CCGGCACATCCACGTATCGGTCAAACTCGAGTTTGACCGATACGTGGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007857.2-296s1c1
Sequence:CCGGCCTGTGCTGCTTGGCACTCTTCTCGAGAAGAGTGCCAAGCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-678s1c1
Sequence:CCGGCAGGATTCACTCCACTACGAACTCGAGTTCGTAGTGGAGTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007857.2-393s1c1
Sequence:CCGGCCTCTGCTATACAAGCAGTTTCTCGAGAAACTGCTTGTATAGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks