EMAIL THIS PAGE TO A FRIEND

DHODH

dihydroorotate dehydrogenase (quinone)

82 Gene Product Result for
Synonyms: DHOdehase POADS URA1
UniProtKB ID: Q02127, A8K8C8, Q6P176
Gene ID:
Human(1723) Summary: The protein encoded by this gene catalyzes the fourth enzymatic step, the ubiquinone-mediated oxidation of dihydroorotate to orotate, in de novo pyrimidine biosynthesis. This protein is a mitochondrial protein located on the outer surface of the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
Mouse(56749) dihydroorotate dehydrogenase
Rat(65156) dihydroorotate dehydrogenase (quinone)
Zebrafish(494065) dihydroorotate dehydrogenase
domestic cat(101100354) dihydroorotate dehydrogenase (quinone)
cow(533873) dihydroorotate dehydrogenase (quinone)
dog(610755) dihydroorotate dehydrogenase (quinone)
chicken(415876) dihydroorotate dehydrogenase (quinone)
domestic guinea pig(100734822) dihydroorotate dehydrogenase (quinone)
naked mole-rat(101704063) dihydroorotate dehydrogenase (quinone)
sheep(101102664) dihydroorotate dehydrogenase (quinone)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41876 Anti-DHODH (AB1) antibody produced in rabbit affinity isolated antibody canine, horse, bovine, rat, guinea pig, rabbit, human, mouse
western blot pricing
AV41942 Anti-DHODH (AB2) antibody produced in rabbit affinity isolated antibody canine, bovine, mouse, horse, zebrafish, rat, rabbit, human, guinea pig
western blot pricing
HPA011942 Anti-DHODH antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA010123 Anti-DHODH antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV41940 Anti-DHODH antibody produced in rabbit IgG fraction of antiserum bovine, human, horse, rabbit, zebrafish, guinea pig, mouse, rat, canine
western blot pricing
SAB2100574 Anti-DHODH antibody produced in rabbit affinity isolated antibody horse, rabbit, human, mouse, rat, guinea pig, bovine, canine
western blot pricing
SAB4500653 Anti-DHODH antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB2104825 Anti-DHODH, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human
western blot pricing
WH0001723M1 Monoclonal Anti-DHODH antibody produced in mouse clone 6E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
L5025 Leflunomide Immunosuppressant human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025193 Rosetta Predictions human pricing
NM_001361 Rosetta Predictions human pricing
NM_001008553 Rosetta Predictions rat pricing
XM_579194 Rosetta Predictions rat pricing
NM_020046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246561 predicted 814
2 SASI_Hs01_00246562 predicted 916
3 SASI_Hs01_00246563 predicted 1012
4 SASI_Hs01_00246564 predicted 270
5 SASI_Hs01_00246565 predicted 265
6 SASI_Hs01_00246566 predicted 257
7 SASI_Hs01_00246567 predicted 911
8 SASI_Hs01_00246568 predicted 832
9 SASI_Hs01_00246569 predicted 224
10 SASI_Hs01_00246570 predicted 1064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331699 predicted 362
2 SASI_Hs01_00148282 predicted 1106
3 SASI_Hs02_00331700 predicted 816
4 SASI_Hs02_00331701 predicted 632
5 SASI_Hs02_00331702 predicted 389
6 SASI_Hs01_00148284 predicted 1317
7 SASI_Hs01_00148286 predicted 260
8 SASI_Hs02_00331703 predicted 784
9 SASI_Hs02_00331704 predicted 442
10 SASI_Hs01_00148289 predicted 1131
11 SASI_Hs01_00148283 predicted 1220
12 SASI_Hs01_00148285 predicted 277
13 SASI_Hs01_00148287 predicted 255
14 SASI_Hs01_00148288 predicted 1219
15 SASI_Hs01_00148290 predicted 222
16 SASI_Hs01_00148291 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199227 predicted 884
2 SASI_Rn02_00199228 predicted 1305
3 SASI_Rn02_00199229 predicted 959
4 SASI_Rn01_00105933 predicted 469
5 SASI_Rn01_00105935 predicted 870
6 SASI_Rn01_00105936 predicted 985
7 SASI_Rn01_00105937 predicted 849
8 SASI_Rn01_00105938 predicted 609
9 SASI_Rn01_00105939 predicted 772
10 SASI_Rn01_00105942 predicted 1199
11 SASI_Rn01_00105934 predicted 1163
12 SASI_Rn01_00105940 predicted 1014
13 SASI_Rn01_00105941 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144893 predicted 938
2 SASI_Rn01_00144894 predicted 904
3 SASI_Rn01_00144895 predicted 963
4 SASI_Rn01_00144896 predicted 984
5 SASI_Rn01_00144897 predicted 915
6 SASI_Rn01_00144898 predicted 922
7 SASI_Rn01_00144899 predicted 970
8 SASI_Rn01_00144900 predicted 935
9 SASI_Rn01_00144901 predicted 897
10 SASI_Rn01_00144902 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087610 predicted 863
2 SASI_Mm01_00087611 predicted 1454
3 SASI_Mm01_00087612 predicted 534
4 SASI_Mm01_00087613 predicted 1567
5 SASI_Mm01_00087614 predicted 1117
6 SASI_Mm01_00087615 predicted 1096
7 SASI_Mm01_00087616 predicted 1652
8 SASI_Mm01_00087617 predicted 596
9 SASI_Mm01_00087618 predicted 616
10 SASI_Mm01_00087619 predicted 719
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020046
VALIDATED
DHODH MISSION shRNA Bacterial Glycerol Stock
dihydroorotate dehydrogenase (quinone)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-820s21c1
Sequence:CCGGTGGGCTGCCTCTGGGAATAAACTCGAGTTTATTCCCAGAGGCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-1675s21c1
Sequence:CCGGCCACTGTCTCTAGATCTAAATCTCGAGATTTAGATCTAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020046.3-1414s21c1
Sequence:CCGGTGAGCTGGAGGCCCTTCTAAACTCGAGTTTAGAAGGGCCTCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-400s21c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-713s21c1
Sequence:CCGGGAGGACCAAGCTGTTATTAACCTCGAGGTTAATAACAGCTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-836s1c1
Sequence:CCGGGCAGACTATGTAGAGGGTGTTCTCGAGAACACCCTCTACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-1090s1c1
Sequence:CCGGCGACGGACTGATCATCACAAACTCGAGTTTGTGATGATCAGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020046.2-361s1c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-508s1c1
Sequence:CCGGCCTGGGCCATAAATTCCGAAACTCGAGTTTCGGAATTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-577s1c1
Sequence:CCGGCGGACTCTATAAGCTGGGCTTCTCGAGAAGCCCAGCTTATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020046
VALIDATED
DHODH MISSION shRNA shRNA Plasmid DNA
dihydroorotate dehydrogenase (quinone)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-820s21c1
Sequence:CCGGTGGGCTGCCTCTGGGAATAAACTCGAGTTTATTCCCAGAGGCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-1675s21c1
Sequence:CCGGCCACTGTCTCTAGATCTAAATCTCGAGATTTAGATCTAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020046.3-1414s21c1
Sequence:CCGGTGAGCTGGAGGCCCTTCTAAACTCGAGTTTAGAAGGGCCTCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-400s21c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-713s21c1
Sequence:CCGGGAGGACCAAGCTGTTATTAACCTCGAGGTTAATAACAGCTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-836s1c1
Sequence:CCGGGCAGACTATGTAGAGGGTGTTCTCGAGAACACCCTCTACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-1090s1c1
Sequence:CCGGCGACGGACTGATCATCACAAACTCGAGTTTGTGATGATCAGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020046.2-361s1c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-508s1c1
Sequence:CCGGCCTGGGCCATAAATTCCGAAACTCGAGTTTCGGAATTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-577s1c1
Sequence:CCGGCGGACTCTATAAGCTGGGCTTCTCGAGAAGCCCAGCTTATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020046
VALIDATED
DHODH MISSION shRNA Lentiviral Transduction Particles
dihydroorotate dehydrogenase (quinone)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-820s21c1
Sequence:CCGGTGGGCTGCCTCTGGGAATAAACTCGAGTTTATTCCCAGAGGCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-1675s21c1
Sequence:CCGGCCACTGTCTCTAGATCTAAATCTCGAGATTTAGATCTAGAGACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020046.3-1414s21c1
Sequence:CCGGTGAGCTGGAGGCCCTTCTAAACTCGAGTTTAGAAGGGCCTCCAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-400s21c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020046.3-713s21c1
Sequence:CCGGGAGGACCAAGCTGTTATTAACCTCGAGGTTAATAACAGCTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-836s1c1
Sequence:CCGGGCAGACTATGTAGAGGGTGTTCTCGAGAACACCCTCTACATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-1090s1c1
Sequence:CCGGCGACGGACTGATCATCACAAACTCGAGTTTGTGATGATCAGTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020046.2-361s1c1
Sequence:CCGGCGACCATTTCTACGCCGAGTACTCGAGTACTCGGCGTAGAAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-508s1c1
Sequence:CCGGCCTGGGCCATAAATTCCGAAACTCGAGTTTCGGAATTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020046.2-577s1c1
Sequence:CCGGCGGACTCTATAAGCTGGGCTTCTCGAGAAGCCCAGCTTATAGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001361
VALIDATED
DHODH MISSION shRNA Bacterial Glycerol Stock
dihydroorotate dehydrogenase (quinone)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-239s1c1
Sequence:CCGGGTGAGAGTTCTGGGCCATAAACTCGAGTTTATGGCCCAGAACTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-829s1c1
Sequence:CCGGCGATGGGCTGATTGTTACGAACTCGAGTTCGTAACAATCAGCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-924s1c1
Sequence:CCGGTCCGGGATTTATCAACTCAAACTCGAGTTTGAGTTGATAAATCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-419s1c1
Sequence:CCGGCAAGCTGTCATTAACAGGTATCTCGAGATACCTGTTAATGACAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-316s1c1
Sequence:CCGGCGGACTTTATAAGATGGGCTTCTCGAGAAGCCCATCTTATAAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001361
VALIDATED
DHODH MISSION shRNA shRNA Plasmid DNA
dihydroorotate dehydrogenase (quinone)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-239s1c1
Sequence:CCGGGTGAGAGTTCTGGGCCATAAACTCGAGTTTATGGCCCAGAACTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-829s1c1
Sequence:CCGGCGATGGGCTGATTGTTACGAACTCGAGTTCGTAACAATCAGCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-924s1c1
Sequence:CCGGTCCGGGATTTATCAACTCAAACTCGAGTTTGAGTTGATAAATCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-419s1c1
Sequence:CCGGCAAGCTGTCATTAACAGGTATCTCGAGATACCTGTTAATGACAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-316s1c1
Sequence:CCGGCGGACTTTATAAGATGGGCTTCTCGAGAAGCCCATCTTATAAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001361
VALIDATED
DHODH MISSION shRNA Lentiviral Transduction Particles
dihydroorotate dehydrogenase (quinone)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-239s1c1
Sequence:CCGGGTGAGAGTTCTGGGCCATAAACTCGAGTTTATGGCCCAGAACTCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-829s1c1
Sequence:CCGGCGATGGGCTGATTGTTACGAACTCGAGTTCGTAACAATCAGCCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-924s1c1
Sequence:CCGGTCCGGGATTTATCAACTCAAACTCGAGTTTGAGTTGATAAATCCCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-419s1c1
Sequence:CCGGCAAGCTGTCATTAACAGGTATCTCGAGATACCTGTTAATGACAGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001361.2-316s1c1
Sequence:CCGGCGGACTTTATAAGATGGGCTTCTCGAGAAGCCCATCTTATAAAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks