EMAIL THIS PAGE TO A FRIEND

DHPS

deoxyhypusine synthase

Synonyms: DHS DS MIG13
UniProtKB ID: P49366, A8K688, M0R1I5, Q13184, Q13276, Q9UDG0
Gene ID:
Human(1725) Summary: This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2011]
Mouse(330817) deoxyhypusine synthase
Rat(288923) deoxyhypusine synthase
Zebrafish(406329) deoxyhypusine synthase
dog(476702) deoxyhypusine synthase
domestic cat(101083659) deoxyhypusine synthase
cow(444988) deoxyhypusine synthase
Horse(100063550) deoxyhypusine synthase
sheep(101107277) deoxyhypusine synthase
naked mole-rat(101708097) deoxyhypusine synthase
domestic guinea pig(100730909) deoxyhypusine synthase
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001930 Rosetta Predictions human pricing
NM_013406 Rosetta Predictions human pricing
NM_013407 Rosetta Predictions human pricing
NM_001004207 Rosetta Predictions rat pricing
NM_001039514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206742 predicted 405
2 SASI_Hs01_00206743 predicted 525
3 SASI_Hs01_00206744 predicted 283
4 SASI_Hs01_00206745 predicted 443
5 SASI_Hs01_00206746 predicted 467
6 SASI_Hs01_00206747 predicted 610
7 SASI_Hs01_00206749 predicted 366
8 SASI_Hs01_00206750 predicted 527
9 SASI_Hs01_00206751 predicted 316
10 SASI_Hs02_00332827 predicted 397
11 SASI_Hs01_00206748 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153285 predicted 407
2 SASI_Hs01_00153286 predicted 520
3 SASI_Hs01_00153287 predicted 279
4 SASI_Hs01_00153288 predicted 439
5 SASI_Hs01_00153289 predicted 466
6 SASI_Hs01_00153290 predicted 603
7 SASI_Hs01_00153292 predicted 374
8 SASI_Hs01_00153293 predicted 530
9 SASI_Hs01_00153294 predicted 313
10 SASI_Hs02_00344788 predicted 391
11 SASI_Hs01_00153291 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216264 predicted 403
2 SASI_Hs01_00216265 predicted 525
3 SASI_Hs01_00216266 predicted 284
4 SASI_Hs01_00216267 predicted 441
5 SASI_Hs01_00216268 predicted 469
6 SASI_Hs01_00216269 predicted 607
7 SASI_Hs01_00216271 predicted 366
8 SASI_Hs01_00216272 predicted 524
9 SASI_Hs01_00216273 predicted 316
10 SASI_Hs02_00344789 predicted 391
11 SASI_Hs01_00216270 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077920 predicted 1060
2 SASI_Rn02_00198186 predicted 663
3 SASI_Rn01_00077922 predicted 342
4 SASI_Rn01_00077923 predicted 571
5 SASI_Rn01_00077924 predicted 728
6 SASI_Rn01_00077925 predicted 834
7 SASI_Rn01_00077926 predicted 502
8 SASI_Rn01_00077927 predicted 1000
9 SASI_Rn01_00077928 predicted 416
10 SASI_Rn01_00077929 predicted 714
11 SASI_Rn01_00077921 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290108 predicted 1093
2 SASI_Mm01_00143774 predicted 809
3 SASI_Mm01_00143775 predicted 747
4 SASI_Mm01_00143776 predicted 570
5 SASI_Mm01_00143777 predicted 733
6 SASI_Mm01_00143778 predicted 390
7 SASI_Mm01_00143779 predicted 980
8 SASI_Mm01_00143780 predicted 626
9 SASI_Mm01_00143781 predicted 951
10 SASI_Mm01_00143782 predicted 436
11 SASI_Mm01_00143783 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001930
VALIDATED
DHPS MISSION shRNA Bacterial Glycerol Stock
deoxyhypusine synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-580s1c1
Sequence:CCGGCGGGATCAATAGGATCGGAAACTCGAGTTTCCGATCCTATTGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-786s1c1
Sequence:CCGGCTGTGTTTAGTCCCGCACTTACTCGAGTAAGTGCGGGACTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-460s1c1
Sequence:CCGGGCACAACATGGTGGACGTATTCTCGAGAATACGTCCACCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-610s1c1
Sequence:CCGGGCCCAATGAGAATTACTGCAACTCGAGTTGCAGTAATTCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-822s1c1
Sequence:CCGGGCGACATGATCTTCTTCCATTCTCGAGAATGGAAGAAGATCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-570s21c1
Sequence:CCGGTCCGGGAGAACGGGATCAATACTCGAGTATTGATCCCGTTCTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-741s21c1
Sequence:CCGGACAACCCAGAGTCCGTGTATTCTCGAGAATACACGGACTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-531s21c1
Sequence:CCGGCCACATACTTGGGCGAGTTTACTCGAGTAAACTCGCCCAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-461s21c1
Sequence:CCGGCACAACATGGTGGACGTATTGCTCGAGCAATACGTCCACCATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-918s21c1
Sequence:CCGGAGTGCACTGGGATGATCATTCCTCGAGGAATGATCATCCCAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001930
VALIDATED
DHPS MISSION shRNA shRNA Plasmid DNA
deoxyhypusine synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-580s1c1
Sequence:CCGGCGGGATCAATAGGATCGGAAACTCGAGTTTCCGATCCTATTGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-786s1c1
Sequence:CCGGCTGTGTTTAGTCCCGCACTTACTCGAGTAAGTGCGGGACTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-460s1c1
Sequence:CCGGGCACAACATGGTGGACGTATTCTCGAGAATACGTCCACCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-610s1c1
Sequence:CCGGGCCCAATGAGAATTACTGCAACTCGAGTTGCAGTAATTCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-822s1c1
Sequence:CCGGGCGACATGATCTTCTTCCATTCTCGAGAATGGAAGAAGATCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-570s21c1
Sequence:CCGGTCCGGGAGAACGGGATCAATACTCGAGTATTGATCCCGTTCTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-741s21c1
Sequence:CCGGACAACCCAGAGTCCGTGTATTCTCGAGAATACACGGACTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-531s21c1
Sequence:CCGGCCACATACTTGGGCGAGTTTACTCGAGTAAACTCGCCCAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-461s21c1
Sequence:CCGGCACAACATGGTGGACGTATTGCTCGAGCAATACGTCCACCATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-918s21c1
Sequence:CCGGAGTGCACTGGGATGATCATTCCTCGAGGAATGATCATCCCAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001930
VALIDATED
DHPS MISSION shRNA Lentiviral Transduction Particles
deoxyhypusine synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-580s1c1
Sequence:CCGGCGGGATCAATAGGATCGGAAACTCGAGTTTCCGATCCTATTGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001930.2-786s1c1
Sequence:CCGGCTGTGTTTAGTCCCGCACTTACTCGAGTAAGTGCGGGACTAAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-460s1c1
Sequence:CCGGGCACAACATGGTGGACGTATTCTCGAGAATACGTCCACCATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-610s1c1
Sequence:CCGGGCCCAATGAGAATTACTGCAACTCGAGTTGCAGTAATTCTCATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001930.2-822s1c1
Sequence:CCGGGCGACATGATCTTCTTCCATTCTCGAGAATGGAAGAAGATCATGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-570s21c1
Sequence:CCGGTCCGGGAGAACGGGATCAATACTCGAGTATTGATCCCGTTCTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-741s21c1
Sequence:CCGGACAACCCAGAGTCCGTGTATTCTCGAGAATACACGGACTCTGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001930.2-531s21c1
Sequence:CCGGCCACATACTTGGGCGAGTTTACTCGAGTAAACTCGCCCAAGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-461s21c1
Sequence:CCGGCACAACATGGTGGACGTATTGCTCGAGCAATACGTCCACCATGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001930.2-918s21c1
Sequence:CCGGAGTGCACTGGGATGATCATTCCTCGAGGAATGATCATCCCAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201408
VALIDATED
DHPS MISSION shRNA Bacterial Glycerol Stock
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-1019s1c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-240s1c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-138s1c1
Sequence:CCGGCCAGGTCCAAGGCTACGACTTCTCGAGAAGTCGTAGCCTTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-366s1c2
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-412s1c2
Sequence:CCGGCAGCACAACATGGATTGGAAACTCGAGTTTCCAATCCATGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201408
VALIDATED
DHPS MISSION shRNA shRNA Plasmid DNA
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-1019s1c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-240s1c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-138s1c1
Sequence:CCGGCCAGGTCCAAGGCTACGACTTCTCGAGAAGTCGTAGCCTTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-366s1c2
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-412s1c2
Sequence:CCGGCAGCACAACATGGATTGGAAACTCGAGTTTCCAATCCATGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201408
VALIDATED
DHPS MISSION shRNA Lentiviral Transduction Particles
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-1019s1c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201408.1-240s1c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-138s1c1
Sequence:CCGGCCAGGTCCAAGGCTACGACTTCTCGAGAAGTCGTAGCCTTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-366s1c2
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201408.1-412s1c2
Sequence:CCGGCAGCACAACATGGATTGGAAACTCGAGTTTCCAATCCATGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039514
VALIDATED
DHPS MISSION shRNA Bacterial Glycerol Stock
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-405s21c1
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-1180s21c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-279s21c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-984s21c1
Sequence:CCGGTGGAGCAGACTACGCTGTTTACTCGAGTAAACAGCGTAGTCTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-748s21c1
Sequence:CCGGGTGTATTATTGGGCCCATAAGCTCGAGCTTATGGGCCCAATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039514
VALIDATED
DHPS MISSION shRNA shRNA Plasmid DNA
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-405s21c1
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-1180s21c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-279s21c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-984s21c1
Sequence:CCGGTGGAGCAGACTACGCTGTTTACTCGAGTAAACAGCGTAGTCTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-748s21c1
Sequence:CCGGGTGTATTATTGGGCCCATAAGCTCGAGCTTATGGGCCCAATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039514
VALIDATED
DHPS MISSION shRNA Lentiviral Transduction Particles
deoxyhypusine synthase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-405s21c1
Sequence:CCGGCAACCTCATCAGTTCAGGCATCTCGAGATGCCTGAACTGATGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-1180s21c1
Sequence:CCGGGCTGAGAAGAATGAAGACTAACTCGAGTTAGTCTTCATTCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-279s21c1
Sequence:CCGGGCAGCAAGTCAACGCCATGATCTCGAGATCATGGCGTTGACTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039514.1-984s21c1
Sequence:CCGGTGGAGCAGACTACGCTGTTTACTCGAGTAAACAGCGTAGTCTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039514.1-748s21c1
Sequence:CCGGGTGTATTATTGGGCCCATAAGCTCGAGCTTATGGGCCCAATAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks