EMAIL THIS PAGE TO A FRIEND

DHRS11

dehydrogenase/reductase (SDR family) member 11

95 Gene Product Result for
Synonyms: ARPG836 SDR24C1
UniProtKB ID: Q6UWP2, B2RDZ3, Q9BUC7, Q9H674
Gene ID:
Mouse(192970) dehydrogenase/reductase (SDR family) member 11
Rat(360583) dehydrogenase/reductase (SDR family) member 11
domestic guinea pig(100733505) dehydrogenase/reductase (SDR family) member 11
naked mole-rat(101704213) dehydrogenase/reductase (SDR family) member 11
sheep(101109465) dehydrogenase/reductase (SDR family) member 11
chicken(395172) dehydrogenase/reductase (SDR family) member 11
cow(510264) dehydrogenase/reductase (SDR family) member 11
domestic cat(101083724) dehydrogenase/reductase (SDR family) member 11
dog(491129) dehydrogenase/reductase (SDR family) member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048236 Anti-DHRS11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA041226 Anti-DHRS11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA053623 Anti-DHRS11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503142 Anti-DHRS11 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB1411425 Anti-DHRS11 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411426 Anti-DHRS11 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
AV49813 Anti-MGC4172 antibody produced in rabbit affinity isolated antibody bovine, human, mouse, horse, rat, guinea pig, rabbit
western blot pricing
SAB2104989 Anti-MGC4172 antibody produced in rabbit affinity isolated antibody horse, rabbit, mouse, rat, guinea pig, human
western blot pricing
SAB1407941 Anti-MGC4172, (N-terminal) antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085131 MISSION® esiRNA esiRNA human AC003042.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024308 Rosetta Predictions human pricing
NM_001014119 Rosetta Predictions rat pricing
NM_177564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127997 predicted 475
2 SASI_Hs01_00127998 predicted 476
3 SASI_Hs01_00127999 predicted 550
4 SASI_Hs01_00128000 predicted 866
5 SASI_Hs01_00128001 predicted 913
6 SASI_Hs02_00356650 predicted 414
7 SASI_Hs01_00128002 predicted 630
8 SASI_Hs01_00128003 predicted 606
9 SASI_Hs01_00128004 predicted 543
10 SASI_Hs01_00128005 predicted 600
11 SASI_Hs01_00128006 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072728 predicted 528
2 SASI_Rn02_00201562 predicted 631
3 SASI_Rn01_00072729 predicted 756
4 SASI_Rn01_00072730 predicted 579
5 SASI_Rn01_00072731 predicted 436
6 SASI_Rn01_00072732 predicted 365
7 SASI_Rn01_00072733 predicted 712
8 SASI_Rn01_00072734 predicted 670
9 SASI_Rn01_00072735 predicted 748
10 SASI_Rn01_00072736 predicted 588
11 SASI_Rn01_00072737 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110012 predicted 819
2 SASI_Mm01_00110013 predicted 790
3 SASI_Mm01_00110014 predicted 988
4 SASI_Mm01_00110015 predicted 743
5 SASI_Mm01_00110016 predicted 1000
6 SASI_Mm01_00110017 predicted 651
7 SASI_Mm01_00110019 predicted 573
8 SASI_Mm01_00110020 predicted 607
9 SASI_Mm02_00347720 predicted 285
10 SASI_Mm01_00110021 predicted 421
11 SASI_Mm01_00110018 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024308
VALIDATED
DHRS11 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-764s1c1
Sequence:CCGGGAGCAAATGAAGTGTCTCAAACTCGAGTTTGAGACACTTCATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-370s1c1
Sequence:CCGGTGTAGACATCTGCATCAACAACTCGAGTTGTTGATGCAGATGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-526s1c1
Sequence:CCGGCGATGGGCACATCATTAACATCTCGAGATGTTAATGATGTGCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-589s1c1
Sequence:CCGGCCACTTCTATAGTGCCACCAACTCGAGTTGGTGGCACTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-704s1c1
Sequence:CCGGGAGACACAATTCGCCTTCAAACTCGAGTTTGAAGGCGAATTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1152s21c1
Sequence:CCGGTCAAATTGCTTCAGTTGTAAACTCGAGTTTACAACTGAAGCAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-552s21c1
Sequence:CCGGGTTGGAAGGACATGTTCAATGCTCGAGCATTGAACATGTCCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1361s21c1
Sequence:CCGGAGGGAGGCCTTCACCTTATATCTCGAGATATAAGGTGAAGGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024308
VALIDATED
DHRS11 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-764s1c1
Sequence:CCGGGAGCAAATGAAGTGTCTCAAACTCGAGTTTGAGACACTTCATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-370s1c1
Sequence:CCGGTGTAGACATCTGCATCAACAACTCGAGTTGTTGATGCAGATGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-526s1c1
Sequence:CCGGCGATGGGCACATCATTAACATCTCGAGATGTTAATGATGTGCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-589s1c1
Sequence:CCGGCCACTTCTATAGTGCCACCAACTCGAGTTGGTGGCACTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-704s1c1
Sequence:CCGGGAGACACAATTCGCCTTCAAACTCGAGTTTGAAGGCGAATTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1152s21c1
Sequence:CCGGTCAAATTGCTTCAGTTGTAAACTCGAGTTTACAACTGAAGCAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-552s21c1
Sequence:CCGGGTTGGAAGGACATGTTCAATGCTCGAGCATTGAACATGTCCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1361s21c1
Sequence:CCGGAGGGAGGCCTTCACCTTATATCTCGAGATATAAGGTGAAGGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024308
VALIDATED
DHRS11 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-764s1c1
Sequence:CCGGGAGCAAATGAAGTGTCTCAAACTCGAGTTTGAGACACTTCATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-370s1c1
Sequence:CCGGTGTAGACATCTGCATCAACAACTCGAGTTGTTGATGCAGATGTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-526s1c1
Sequence:CCGGCGATGGGCACATCATTAACATCTCGAGATGTTAATGATGTGCCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_024308.2-589s1c1
Sequence:CCGGCCACTTCTATAGTGCCACCAACTCGAGTTGGTGGCACTATAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024308.2-704s1c1
Sequence:CCGGGAGACACAATTCGCCTTCAAACTCGAGTTTGAAGGCGAATTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1152s21c1
Sequence:CCGGTCAAATTGCTTCAGTTGTAAACTCGAGTTTACAACTGAAGCAATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-552s21c1
Sequence:CCGGGTTGGAAGGACATGTTCAATGCTCGAGCATTGAACATGTCCTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024308.3-1361s21c1
Sequence:CCGGAGGGAGGCCTTCACCTTATATCTCGAGATATAAGGTGAAGGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177564
VALIDATED
DHRS11 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.2-337s1c1
Sequence:CCGGCGTGGATATCTGCATCAACAACTCGAGTTGTTGATGCAGATATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-671s1c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-1037s1c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-496s1c1
Sequence:CCGGCGGGCACATCATTAACATCAACTCGAGTTGATGTTAATGATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177564.2-1023s1c1
Sequence:CCGGGAAGACAGAATCTCGACTGTTCTCGAGAACAGTCGAGATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-693s21c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-583s21c1
Sequence:CCGGTCTATAGTGCGACTAAGTATGCTCGAGCATACTTAGTCGCACTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-493s21c1
Sequence:CCGGCCATGAAGGAGCGGAACATAGCTCGAGCTATGTTCCGCTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.4-290s1c1
Sequence:CCGGCAGATGTGACCTGTCAAATGACTCGAGTCATTTGACAGGTCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177564.4-1059s21c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-791s21c1
Sequence:CCGGGGCTGTCATCTACGTTCTTAGCTCGAGCTAAGAACGTAGATGACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177564
VALIDATED
DHRS11 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.2-337s1c1
Sequence:CCGGCGTGGATATCTGCATCAACAACTCGAGTTGTTGATGCAGATATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-671s1c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-1037s1c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-496s1c1
Sequence:CCGGCGGGCACATCATTAACATCAACTCGAGTTGATGTTAATGATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177564.2-1023s1c1
Sequence:CCGGGAAGACAGAATCTCGACTGTTCTCGAGAACAGTCGAGATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-693s21c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-583s21c1
Sequence:CCGGTCTATAGTGCGACTAAGTATGCTCGAGCATACTTAGTCGCACTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-493s21c1
Sequence:CCGGCCATGAAGGAGCGGAACATAGCTCGAGCTATGTTCCGCTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.4-290s1c1
Sequence:CCGGCAGATGTGACCTGTCAAATGACTCGAGTCATTTGACAGGTCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177564.4-1059s21c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-791s21c1
Sequence:CCGGGGCTGTCATCTACGTTCTTAGCTCGAGCTAAGAACGTAGATGACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177564
VALIDATED
DHRS11 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 11
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.2-337s1c1
Sequence:CCGGCGTGGATATCTGCATCAACAACTCGAGTTGTTGATGCAGATATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-671s1c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-1037s1c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177564.2-496s1c1
Sequence:CCGGCGGGCACATCATTAACATCAACTCGAGTTGATGTTAATGATGTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177564.2-1023s1c1
Sequence:CCGGGAAGACAGAATCTCGACTGTTCTCGAGAACAGTCGAGATTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-693s21c1
Sequence:CCGGGAGACACAGTTCGCCTTCAAACTCGAGTTTGAAGGCGAACTGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-583s21c1
Sequence:CCGGTCTATAGTGCGACTAAGTATGCTCGAGCATACTTAGTCGCACTATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-493s21c1
Sequence:CCGGCCATGAAGGAGCGGAACATAGCTCGAGCTATGTTCCGCTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177564.4-290s1c1
Sequence:CCGGCAGATGTGACCTGTCAAATGACTCGAGTCATTTGACAGGTCACATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177564.4-1059s21c1
Sequence:CCGGGACTGTTCTATCTAACTTCTTCTCGAGAAGAAGTTAGATAGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177564.4-791s21c1
Sequence:CCGGGGCTGTCATCTACGTTCTTAGCTCGAGCTAAGAACGTAGATGACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks