EMAIL THIS PAGE TO A FRIEND

DHRS12

dehydrogenase/reductase (SDR family) member 12

36 Gene Product Result for
Synonyms: SDR40C1
UniProtKB ID: A0PJE2, Q96GB2, Q9H8H1
Gene ID:
Human(79758) Summary: This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Zebrafish(556393) dehydrogenase/reductase (SDR family) member 12
chicken(770438) dehydrogenase/reductase (SDR family) member 12
cow(507276) dehydrogenase/reductase (SDR family) member 12
sheep(101106859) dehydrogenase/reductase (SDR family) member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024705 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140271 MISSION® esiRNA esiRNA human DHRS12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031719 Rosetta Predictions human pricing
NM_024705 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050510 predicted 207
2 SASI_Hs01_00050511 predicted 331
3 SASI_Hs01_00050512 predicted 370
4 SASI_Hs01_00050513 predicted 342
5 SASI_Hs01_00050515 predicted 366
6 SASI_Hs01_00050516 predicted 247
7 SASI_Hs02_00307751 predicted 255
8 SASI_Hs01_00050514 predicted 280
9 SASI_Hs02_00307752 predicted 344
10 SASI_Hs02_00307753 predicted 347
11 SASI_Hs01_00050517 predicted 382
12 SASI_Hs01_00050518 predicted 226
13 SASI_Hs01_00050519 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186355 predicted 266
2 SASI_Hs01_00186356 predicted 390
3 SASI_Hs01_00186357 predicted 435
4 SASI_Hs01_00186358 predicted 401
5 SASI_Hs01_00186360 predicted 431
6 SASI_Hs01_00186361 predicted 302
7 SASI_Hs02_00357162 predicted 317
8 SASI_Hs01_00186359 predicted 334
9 SASI_Hs02_00357163 predicted 401
10 SASI_Hs02_00357164 predicted 398
11 SASI_Hs01_00186362 predicted 434
12 SASI_Hs01_00186363 predicted 275
13 SASI_Hs01_00186364 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024705
DHRS12 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-549s21c1
Sequence:CCGGTTGATGGAACTATGGTCTATGCTCGAGCATAGACCATAGTTCCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-340s21c1
Sequence:CCGGTGCAGGTTGCATGGTCAATAACTCGAGTTATTGACCATGCAACCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-207s21c1
Sequence:CCGGCAAAGCAACTGCCCTTGAAATCTCGAGATTTCAAGGGCAGTTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-262s21c1
Sequence:CCGGCTTGTCTGATCCCAAGCAAATCTCGAGATTTGCTTGGGATCAGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024705.1-1723s21c1
Sequence:CCGGCCGAAGAGGAGAAACTCATTGCTCGAGCAATGAGTTTCTCCTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024705.1-796s1c1
Sequence:CCGGCCGCTTCTTTCAAGGTGACTTCTCGAGAAGTCACCTTGAAAGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024705.1-1483s1c1
Sequence:CCGGGCACTTTACATATCAATCCATCTCGAGATGGATTGATATGTAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024705
DHRS12 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-549s21c1
Sequence:CCGGTTGATGGAACTATGGTCTATGCTCGAGCATAGACCATAGTTCCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-340s21c1
Sequence:CCGGTGCAGGTTGCATGGTCAATAACTCGAGTTATTGACCATGCAACCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-207s21c1
Sequence:CCGGCAAAGCAACTGCCCTTGAAATCTCGAGATTTCAAGGGCAGTTGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-262s21c1
Sequence:CCGGCTTGTCTGATCCCAAGCAAATCTCGAGATTTGCTTGGGATCAGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024705.1-1723s21c1
Sequence:CCGGCCGAAGAGGAGAAACTCATTGCTCGAGCAATGAGTTTCTCCTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024705.1-796s1c1
Sequence:CCGGCCGCTTCTTTCAAGGTGACTTCTCGAGAAGTCACCTTGAAAGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024705.1-1483s1c1
Sequence:CCGGGCACTTTACATATCAATCCATCTCGAGATGGATTGATATGTAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024705
DHRS12 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-549s21c1
Sequence:CCGGTTGATGGAACTATGGTCTATGCTCGAGCATAGACCATAGTTCCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-340s21c1
Sequence:CCGGTGCAGGTTGCATGGTCAATAACTCGAGTTATTGACCATGCAACCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-207s21c1
Sequence:CCGGCAAAGCAACTGCCCTTGAAATCTCGAGATTTCAAGGGCAGTTGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024705.1-262s21c1
Sequence:CCGGCTTGTCTGATCCCAAGCAAATCTCGAGATTTGCTTGGGATCAGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024705.1-1723s21c1
Sequence:CCGGCCGAAGAGGAGAAACTCATTGCTCGAGCAATGAGTTTCTCCTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024705.1-796s1c1
Sequence:CCGGCCGCTTCTTTCAAGGTGACTTCTCGAGAAGTCACCTTGAAAGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024705.1-1483s1c1
Sequence:CCGGGCACTTTACATATCAATCCATCTCGAGATGGATTGATATGTAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)