EMAIL THIS PAGE TO A FRIEND

DHRS1

dehydrogenase/reductase (SDR family) member 1

65 Gene Product Result for
Synonyms: SDR19C1
UniProtKB ID: Q96LJ7, D3DS71, Q8NDG3, Q96B59, Q96CQ5
Gene ID:
Human(115817) Summary: This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded enzyme contains a conserved catalytic domain and likely functions as an oxidoreductase. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
Mouse(52585) dehydrogenase/reductase (SDR family) member 1
Rat(290234) dehydrogenase/reductase (SDR family) member 1
Zebrafish(368670) dehydrogenase/reductase (SDR family) member 1
domestic cat(101082752) dehydrogenase/reductase (SDR family) member 1
cow(528832) dehydrogenase/reductase (SDR family) member 1
dog(480270) dehydrogenase/reductase (SDR family) member 1
domestic guinea pig(100722187) dehydrogenase/reductase (SDR family) member 1
naked mole-rat(101722161) dehydrogenase/reductase (SDR family) member 1
sheep(101113760) dehydrogenase/reductase (SDR family) member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138452 Rosetta Predictions human pricing
NM_001007621 Rosetta Predictions rat pricing
NM_026819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069222 predicted 1172
2 SASI_Hs01_00069224 predicted 1087
3 SASI_Hs01_00069225 predicted 1196
4 SASI_Hs02_00363622 predicted 1090
5 SASI_Hs02_00363623 predicted 943
6 SASI_Hs01_00069226 predicted 1040
7 SASI_Hs01_00069227 predicted 763
8 SASI_Hs01_00069229 predicted 897
9 SASI_Hs01_00069230 predicted 283
10 SASI_Hs01_00069231 predicted 1027
11 SASI_Hs01_00069223 predicted 971
12 SASI_Hs01_00069228 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040835 predicted 643
2 SASI_Rn01_00040836 predicted 745
3 SASI_Rn01_00040837 predicted 619
4 SASI_Rn01_00040838 predicted 853
5 SASI_Rn01_00040839 predicted 1304
6 SASI_Rn01_00040840 predicted 1274
7 SASI_Rn01_00040841 predicted 535
8 SASI_Rn01_00040842 predicted 798
9 SASI_Rn01_00040843 predicted 684
10 SASI_Rn01_00040844 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182098 predicted 255
2 SASI_Mm01_00182099 predicted 411
3 SASI_Mm01_00182100 predicted 976
4 SASI_Mm01_00182101 predicted 536
5 SASI_Mm01_00182102 predicted 556
6 SASI_Mm01_00182103 predicted 207
7 SASI_Mm01_00182104 predicted 678
8 SASI_Mm01_00182105 predicted 1165
9 SASI_Mm02_00330974 predicted 787
10 SASI_Mm01_00182106 predicted 863
11 SASI_Mm01_00182097 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026819
VALIDATED
DHRS1 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1208s21c1
Sequence:CCGGTGGTAGAACAAACCCGCTTTCCTCGAGGAAAGCGGGTTTGTTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1004s21c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-824s21c1
Sequence:CCGGACTCCTGAGGACCCTCTATTTCTCGAGAAATAGAGGGTCCTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-449s21c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-424s21c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-449s1c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1117s1c1
Sequence:CCGGCCTCTACAACAGCAAATTCTACTCGAGTAGAATTTGCTGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-574s1c1
Sequence:CCGGCCACTACTTATGCTCTGTGTACTCGAGTACACAGAGCATAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-424s1c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1004s1c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026819
VALIDATED
DHRS1 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1208s21c1
Sequence:CCGGTGGTAGAACAAACCCGCTTTCCTCGAGGAAAGCGGGTTTGTTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1004s21c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-824s21c1
Sequence:CCGGACTCCTGAGGACCCTCTATTTCTCGAGAAATAGAGGGTCCTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-449s21c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-424s21c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-449s1c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1117s1c1
Sequence:CCGGCCTCTACAACAGCAAATTCTACTCGAGTAGAATTTGCTGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-574s1c1
Sequence:CCGGCCACTACTTATGCTCTGTGTACTCGAGTACACAGAGCATAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-424s1c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1004s1c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026819
VALIDATED
DHRS1 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1208s21c1
Sequence:CCGGTGGTAGAACAAACCCGCTTTCCTCGAGGAAAGCGGGTTTGTTCTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-1004s21c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-824s21c1
Sequence:CCGGACTCCTGAGGACCCTCTATTTCTCGAGAAATAGAGGGTCCTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-449s21c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026819.2-424s21c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-449s1c1
Sequence:CCGGCGGCTAGATGTTCTGGTCAATCTCGAGATTGACCAGAACATCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1117s1c1
Sequence:CCGGCCTCTACAACAGCAAATTCTACTCGAGTAGAATTTGCTGTTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-574s1c1
Sequence:CCGGCCACTACTTATGCTCTGTGTACTCGAGTACACAGAGCATAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-424s1c1
Sequence:CCGGGCAAGTAGATCGGGAACAGAACTCGAGTTCTGTTCCCGATCTACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026819.2-1004s1c1
Sequence:CCGGCGCCCTGTCAAAGACTACTTTCTCGAGAAAGTAGTCTTTGACAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138452
VALIDATED
DHRS1 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138452.1-1299s21c1
Sequence:GTACCGGGTTTACCCATACCCTTGATATCTCGAGATATCAAGGGTATGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1168s21c1
Sequence:CCGGGTGTGCCCAAGTGGATTATTGCTCGAGCAATAATCCACTTGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-605s21c1
Sequence:CCGGTGCCTCCATGTGGGATGATATCTCGAGATATCATCCCACATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-407s21c1
Sequence:CCGGTGTTGCTCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1192s21c1
Sequence:CCGGTCTACACTAGCAAGTTCTAACCTCGAGGTTAGAACTTGCTAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-1082s1c1
Sequence:CCGGCGTCCAAGACTATTTGTCTTTCTCGAGAAAGACAAATAGTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-909s1c1
Sequence:CCGGCCTGTGTTGAAGCAGTTCAAACTCGAGTTTGAACTGCTTCAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-952s1c1
Sequence:CCGGCCACAGAATTGAGTGGCAAATCTCGAGATTTGCCACTCAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_138452.1-1190s1c1
Sequence:CCGGCCTCTACACTAGCAAGTTCTACTCGAGTAGAACTTGCTAGTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-531s1c1
Sequence:CCGGGTGCTGGTCAACAATGCTTATCTCGAGATAAGCATTGTTGACCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138452
VALIDATED
DHRS1 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138452.1-1299s21c1
Sequence:GTACCGGGTTTACCCATACCCTTGATATCTCGAGATATCAAGGGTATGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1168s21c1
Sequence:CCGGGTGTGCCCAAGTGGATTATTGCTCGAGCAATAATCCACTTGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-605s21c1
Sequence:CCGGTGCCTCCATGTGGGATGATATCTCGAGATATCATCCCACATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-407s21c1
Sequence:CCGGTGTTGCTCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1192s21c1
Sequence:CCGGTCTACACTAGCAAGTTCTAACCTCGAGGTTAGAACTTGCTAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-1082s1c1
Sequence:CCGGCGTCCAAGACTATTTGTCTTTCTCGAGAAAGACAAATAGTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-909s1c1
Sequence:CCGGCCTGTGTTGAAGCAGTTCAAACTCGAGTTTGAACTGCTTCAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-952s1c1
Sequence:CCGGCCACAGAATTGAGTGGCAAATCTCGAGATTTGCCACTCAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_138452.1-1190s1c1
Sequence:CCGGCCTCTACACTAGCAAGTTCTACTCGAGTAGAACTTGCTAGTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-531s1c1
Sequence:CCGGGTGCTGGTCAACAATGCTTATCTCGAGATAAGCATTGTTGACCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138452
VALIDATED
DHRS1 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138452.1-1299s21c1
Sequence:GTACCGGGTTTACCCATACCCTTGATATCTCGAGATATCAAGGGTATGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1168s21c1
Sequence:CCGGGTGTGCCCAAGTGGATTATTGCTCGAGCAATAATCCACTTGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-605s21c1
Sequence:CCGGTGCCTCCATGTGGGATGATATCTCGAGATATCATCCCACATGGAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-407s21c1
Sequence:CCGGTGTTGCTCAGGAGGCACAATCCTCGAGGATTGTGCCTCCTGAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138452.1-1192s21c1
Sequence:CCGGTCTACACTAGCAAGTTCTAACCTCGAGGTTAGAACTTGCTAGTGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-1082s1c1
Sequence:CCGGCGTCCAAGACTATTTGTCTTTCTCGAGAAAGACAAATAGTCTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-909s1c1
Sequence:CCGGCCTGTGTTGAAGCAGTTCAAACTCGAGTTTGAACTGCTTCAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-952s1c1
Sequence:CCGGCCACAGAATTGAGTGGCAAATCTCGAGATTTGCCACTCAATTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_138452.1-1190s1c1
Sequence:CCGGCCTCTACACTAGCAAGTTCTACTCGAGTAGAACTTGCTAGTGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138452.1-531s1c1
Sequence:CCGGGTGCTGGTCAACAATGCTTATCTCGAGATAAGCATTGTTGACCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks