EMAIL THIS PAGE TO A FRIEND

DHRS2

dehydrogenase/reductase (SDR family) member 2

66 Gene Product Result for
Synonyms: HEP27 SDR25C1
UniProtKB ID: Q13268, D3DS54, Q53GS4, Q7Z789, Q9H2R2
Gene ID:
Mouse(71412) dehydrogenase/reductase member 2
Rat(691464) dehydrogenase/reductase (SDR family) member 2
dog(490616) dehydrogenase/reductase (SDR family) member 2
domestic cat(101097899) dehydrogenase/reductase (SDR family) member 2
Horse(100055221) dehydrogenase/reductase SDR family member 2
domestic guinea pig(100714690) dehydrogenase/reductase (SDR family) member 2
naked mole-rat(101706828) dehydrogenase/reductase (SDR family) member 2
Domestic Rabbit(100347425) dehydrogenase/reductase member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005794 Rosetta Predictions human pricing
NM_182908 Rosetta Predictions human pricing
XM_001078405 Rosetta Predictions rat pricing
NM_027790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190956 predicted 1377
2 SASI_Hs01_00190957 predicted 1375
3 SASI_Hs01_00190958 predicted 1406
4 SASI_Hs01_00190959 predicted 858
5 SASI_Hs01_00190960 predicted 856
6 SASI_Hs01_00190961 predicted 690
7 SASI_Hs01_00190962 predicted 1381
8 SASI_Hs01_00190963 predicted 1346
9 SASI_Hs01_00190964 predicted 842
10 SASI_Hs01_00190965 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082194 predicted 1392
2 SASI_Hs01_00082195 predicted 1380
3 SASI_Hs01_00082196 predicted 1410
4 SASI_Hs01_00082197 predicted 850
5 SASI_Hs01_00082198 predicted 853
6 SASI_Hs01_00082199 predicted 693
7 SASI_Hs01_00082200 predicted 1383
8 SASI_Hs01_00082201 predicted 1361
9 SASI_Hs01_00082202 predicted 851
10 SASI_Hs01_00082203 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360654 predicted 446
2 SASI_Rn02_00360655 predicted 404
3 SASI_Rn02_00360656 predicted 417
4 SASI_Rn02_00360657 predicted 499
5 SASI_Rn02_00360658 predicted 610
6 SASI_Rn02_00360659 predicted 500
7 SASI_Rn02_00360660 predicted 551
8 SASI_Rn02_00360661 predicted 395
9 SASI_Rn02_00360662 predicted 546
10 SASI_Rn02_00360663 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095774 predicted 674
2 SASI_Mm01_00095775 predicted 479
3 SASI_Mm01_00095776 predicted 660
4 SASI_Mm01_00095777 predicted 754
5 SASI_Mm01_00095778 predicted 632
6 SASI_Mm02_00332741 predicted 585
7 SASI_Mm01_00095779 predicted 346
8 SASI_Mm02_00332742 predicted 895
9 SASI_Mm01_00095780 predicted 454
10 SASI_Mm01_00095781 predicted 871
11 SASI_Mm01_00095782 predicted 856
12 SASI_Mm01_00095783 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182908
VALIDATED
DHRS2 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1079s21c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182908.4-1395s21c1
Sequence:CCGGATTCTGCCAGACTAGCAATTTCTCGAGAAATTGCTAGTCTGGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182908.4-486s21c1
Sequence:CCGGTCATCCCTGTGCTAGGCTTTCCTCGAGGAAAGCCTAGCACAGGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1030s21c1
Sequence:CCGGCTCACTAGAACACTGGCATTGCTCGAGCAATGCCAGTGTTCTAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1070s1c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182908.3-486s1c1
Sequence:CCGGTGCTAGGCTTTCTGTGAGGATCTCGAGATCCTCACAGAAAGCCTAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-470s1c1
Sequence:CCGGGCTGGTTTCATCCCTGTGCTACTCGAGTAGCACAGGGATGAAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-946s1c1
Sequence:CCGGGTCTCTTCCATTGCAGCTTATCTCGAGATAAGCTGCAATGGAAGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1116s1c1
Sequence:CCGGGAGGATTGGTTTCATGGGAATCTCGAGATTCCCATGAAACCAATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182908
VALIDATED
DHRS2 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1079s21c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182908.4-1395s21c1
Sequence:CCGGATTCTGCCAGACTAGCAATTTCTCGAGAAATTGCTAGTCTGGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182908.4-486s21c1
Sequence:CCGGTCATCCCTGTGCTAGGCTTTCCTCGAGGAAAGCCTAGCACAGGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1030s21c1
Sequence:CCGGCTCACTAGAACACTGGCATTGCTCGAGCAATGCCAGTGTTCTAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1070s1c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182908.3-486s1c1
Sequence:CCGGTGCTAGGCTTTCTGTGAGGATCTCGAGATCCTCACAGAAAGCCTAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-470s1c1
Sequence:CCGGGCTGGTTTCATCCCTGTGCTACTCGAGTAGCACAGGGATGAAACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-946s1c1
Sequence:CCGGGTCTCTTCCATTGCAGCTTATCTCGAGATAAGCTGCAATGGAAGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1116s1c1
Sequence:CCGGGAGGATTGGTTTCATGGGAATCTCGAGATTCCCATGAAACCAATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182908
VALIDATED
DHRS2 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1079s21c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182908.4-1395s21c1
Sequence:CCGGATTCTGCCAGACTAGCAATTTCTCGAGAAATTGCTAGTCTGGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_182908.4-486s21c1
Sequence:CCGGTCATCCCTGTGCTAGGCTTTCCTCGAGGAAAGCCTAGCACAGGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182908.4-1030s21c1
Sequence:CCGGCTCACTAGAACACTGGCATTGCTCGAGCAATGCCAGTGTTCTAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1070s1c1
Sequence:CCGGACTGCGTGGTTCCAGGAATTACTCGAGTAATTCCTGGAACCACGCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_182908.3-486s1c1
Sequence:CCGGTGCTAGGCTTTCTGTGAGGATCTCGAGATCCTCACAGAAAGCCTAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-470s1c1
Sequence:CCGGGCTGGTTTCATCCCTGTGCTACTCGAGTAGCACAGGGATGAAACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-946s1c1
Sequence:CCGGGTCTCTTCCATTGCAGCTTATCTCGAGATAAGCTGCAATGGAAGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182908.3-1116s1c1
Sequence:CCGGGAGGATTGGTTTCATGGGAATCTCGAGATTCCCATGAAACCAATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027790
DHRS2 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-652s1c1
Sequence:CCGGGACAAGATCCTGGATGTAAATCTCGAGATTTACATCCAGGATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-454s1c1
Sequence:CCGGGTAGATGAAGCTGTGACCATACTCGAGTATGGTCACAGCTTCATCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-927s1c1
Sequence:CCGGGCCAAACATGCTGCCTGACATCTCGAGATGTCAGGCAGCATGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-995s1c1
Sequence:CCGGCCGGGCTTGTATCCTTCCTGTCTCGAGACAGGAAGGATACAAGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-489s1c1
Sequence:CCGGGCTGAGTGTGACTGGCACCATCTCGAGATGGTGCCAGTCACACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027790
DHRS2 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-652s1c1
Sequence:CCGGGACAAGATCCTGGATGTAAATCTCGAGATTTACATCCAGGATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-454s1c1
Sequence:CCGGGTAGATGAAGCTGTGACCATACTCGAGTATGGTCACAGCTTCATCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-927s1c1
Sequence:CCGGGCCAAACATGCTGCCTGACATCTCGAGATGTCAGGCAGCATGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-995s1c1
Sequence:CCGGCCGGGCTTGTATCCTTCCTGTCTCGAGACAGGAAGGATACAAGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-489s1c1
Sequence:CCGGGCTGAGTGTGACTGGCACCATCTCGAGATGGTGCCAGTCACACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027790
DHRS2 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-652s1c1
Sequence:CCGGGACAAGATCCTGGATGTAAATCTCGAGATTTACATCCAGGATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-454s1c1
Sequence:CCGGGTAGATGAAGCTGTGACCATACTCGAGTATGGTCACAGCTTCATCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-927s1c1
Sequence:CCGGGCCAAACATGCTGCCTGACATCTCGAGATGTCAGGCAGCATGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-995s1c1
Sequence:CCGGCCGGGCTTGTATCCTTCCTGTCTCGAGACAGGAAGGATACAAGCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027790.1-489s1c1
Sequence:CCGGGCTGAGTGTGACTGGCACCATCTCGAGATGGTGCCAGTCACACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)