EMAIL THIS PAGE TO A FRIEND

DHRS3

dehydrogenase/reductase (SDR family) member 3

90 Gene Product Result for
Synonyms: DD83.1 RDH17 Rsdr1 SDR1 SDR16C1 retSDR1
UniProtKB ID: O75911, B2R7F3, Q5VUY3, Q6UY38, Q9BUC8
Gene ID:
Human(9249) Summary: Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]
Mouse(20148) dehydrogenase/reductase (SDR family) member 3
Rat(313689) dehydrogenase/reductase (SDR family) member 3
sheep(101109288) dehydrogenase/reductase (SDR family) member 3
naked mole-rat(101707915) dehydrogenase/reductase (SDR family) member 3
domestic guinea pig(100722728) dehydrogenase/reductase (SDR family) member 3
chicken(419480) dehydrogenase/reductase (SDR family) member 3
domestic cat(101080307) dehydrogenase/reductase (SDR family) member 3
cow(281482) dehydrogenase/reductase (SDR family) member 3
dog(487436) dehydrogenase/reductase (SDR family) member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004753 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004753 Rosetta Predictions human pricing
NM_001037199 Rosetta Predictions rat pricing
NM_011303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058501 predicted 1361
2 SASI_Hs02_00338241 predicted 1349
3 SASI_Hs01_00058502 predicted 1318
4 SASI_Hs01_00058503 predicted 850
5 SASI_Hs01_00058504 predicted 724
6 SASI_Hs01_00058505 predicted 1039
7 SASI_Hs01_00058506 predicted 538
8 SASI_Hs01_00058507 predicted 1541
9 SASI_Hs01_00058508 predicted 1335
10 SASI_Hs01_00058509 predicted 1450
11 SASI_Hs01_00058510 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204308 predicted 874
2 SASI_Rn01_00034038 predicted 1044
3 SASI_Rn01_00034039 predicted 1224
4 SASI_Rn01_00034040 predicted 774
5 SASI_Rn01_00034042 predicted 1352
6 SASI_Rn01_00034043 predicted 739
7 SASI_Rn01_00034044 predicted 851
8 SASI_Rn01_00034045 predicted 962
9 SASI_Rn01_00034046 predicted 1000
10 SASI_Rn01_00034047 predicted 514
11 SASI_Rn01_00034041 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042774 predicted 916
2 SASI_Mm01_00042775 predicted 1568
3 SASI_Mm01_00042776 predicted 763
4 SASI_Mm01_00042777 predicted 1431
5 SASI_Mm01_00042778 predicted 1500
6 SASI_Mm01_00042779 predicted 934
7 SASI_Mm01_00042780 predicted 1636
8 SASI_Mm01_00042781 predicted 1185
9 SASI_Mm01_00042783 predicted 1404
10 SASI_Mm02_00320373 predicted 460
11 SASI_Mm01_00042782 predicted 1590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011303
VALIDATED
DHRS3 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011303.2-2107s1c1
Sequence:CCGGGCCATTCATCTGTGGAAGAAACTCGAGTTTCTTCCACAGATGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1317s1c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-477s1c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1190s1c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-944s1c1
Sequence:CCGGGCCATATTGTGTGCCTCAATTCTCGAGAATTGAGGCACACAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1314s21c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-474s21c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1637s21c1
Sequence:CCGGGCCTGATGTGCATCTACTATTCTCGAGAATAGTAGATGCACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-928s21c1
Sequence:CCGGGAACTCCAGAACGGCCATATTCTCGAGAATATGGCCGTTCTGGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1187s21c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011303
VALIDATED
DHRS3 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011303.2-2107s1c1
Sequence:CCGGGCCATTCATCTGTGGAAGAAACTCGAGTTTCTTCCACAGATGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1317s1c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-477s1c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1190s1c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-944s1c1
Sequence:CCGGGCCATATTGTGTGCCTCAATTCTCGAGAATTGAGGCACACAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1314s21c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-474s21c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1637s21c1
Sequence:CCGGGCCTGATGTGCATCTACTATTCTCGAGAATAGTAGATGCACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-928s21c1
Sequence:CCGGGAACTCCAGAACGGCCATATTCTCGAGAATATGGCCGTTCTGGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1187s21c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011303
VALIDATED
DHRS3 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011303.2-2107s1c1
Sequence:CCGGGCCATTCATCTGTGGAAGAAACTCGAGTTTCTTCCACAGATGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1317s1c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-477s1c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-1190s1c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011303.2-944s1c1
Sequence:CCGGGCCATATTGTGTGCCTCAATTCTCGAGAATTGAGGCACACAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1314s21c1
Sequence:CCGGCACCTGTATGAACACCTTTAACTCGAGTTAAAGGTGTTCATACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-474s21c1
Sequence:CCGGCCCTCTGCAAATGATCTATTTCTCGAGAAATAGATCATTTGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1637s21c1
Sequence:CCGGGCCTGATGTGCATCTACTATTCTCGAGAATAGTAGATGCACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-928s21c1
Sequence:CCGGGAACTCCAGAACGGCCATATTCTCGAGAATATGGCCGTTCTGGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011303.5-1187s21c1
Sequence:CCGGCGGTAGATGCTGTGCAACAAACTCGAGTTTGTTGCACAGCATCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004753
VALIDATED
DHRS3 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-970s1c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-992s1c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-148s1c1
Sequence:CCGGGTTCCCTCTACAGATGATCTACTCGAGTAGATCATCTGTAGAGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-325s1c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-1188s1c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004753.4-1540s21c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004753.4-677s21c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1344s21c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1322s21c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004753
VALIDATED
DHRS3 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-970s1c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-992s1c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-148s1c1
Sequence:CCGGGTTCCCTCTACAGATGATCTACTCGAGTAGATCATCTGTAGAGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-325s1c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-1188s1c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004753.4-1540s21c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004753.4-677s21c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1344s21c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1322s21c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004753
VALIDATED
DHRS3 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-970s1c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-992s1c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004753.3-148s1c1
Sequence:CCGGGTTCCCTCTACAGATGATCTACTCGAGTAGATCATCTGTAGAGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-325s1c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004753.3-1188s1c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004753.4-1540s21c1
Sequence:CCGGGCACAGGACTGATGGGTATAACTCGAGTTATACCCATCAGTCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004753.4-677s21c1
Sequence:CCGGCCGGACTGAGAAATGCCTGAACTCGAGTTCAGGCATTTCTCAGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1344s21c1
Sequence:CCGGACCTGCATGAACACTTTCAAACTCGAGTTTGAAAGTGTTCATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004753.4-1322s21c1
Sequence:CCGGCCACAAATTCTCAGGAACCTACTCGAGTAGGTTCCTGAGAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)