EMAIL THIS PAGE TO A FRIEND

DHRS4

dehydrogenase/reductase (SDR family) member 4

82 Gene Product Result for
Synonyms: CR NRDR PHCR PSCD SCAD-SRL SDR-SRL SDR25C1 SDR25C2
Gene ID:
Mouse(28200) dehydrogenase/reductase (SDR family) member 4
Rat(266686) dehydrogenase/reductase (SDR family) member 4
chicken(426247) dehydrogenase/reductase (SDR family) member 4
dog(480254) dehydrogenase/reductase (SDR family) member 4
Horse(100054994) dehydrogenase/reductase SDR family member 4
cow(281360) dehydrogenase/reductase (SDR family) member 4
domestic guinea pig(100719714) dehydrogenase/reductase (SDR family) member 4
naked mole-rat(101708169) dehydrogenase/reductase (SDR family) member 4
Domestic Rabbit(100009020) dehydrogenase/reductase (SDR family) member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021004 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU168411 MISSION® esiRNA esiRNA targeting mouse Dhrs4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021004 Rosetta Predictions human pricing
NM_153315 Rosetta Predictions rat pricing
NM_001037938 Rosetta Predictions mouse pricing
NM_030686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044089 predicted 433
2 SASI_Hs01_00044092 predicted 595
3 SASI_Hs02_00354471 predicted 388
4 SASI_Hs01_00044093 predicted 516
5 SASI_Hs01_00044098 predicted 763
6 SASI_Hs02_00354472 predicted 351
7 SASI_Hs02_00354473 predicted 439
8 SASI_Hs01_00044091 predicted 417
9 SASI_Hs02_00354474 predicted 384
10 SASI_Hs02_00354475 predicted 341
11 SASI_Hs01_00044090 predicted 568
12 SASI_Hs01_00044094 predicted 490
13 SASI_Hs01_00044095 predicted 563
14 SASI_Hs01_00044096 predicted 643
15 SASI_Hs01_00044097 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067459 predicted 475
2 SASI_Rn01_00067460 predicted 856
3 SASI_Rn01_00067461 predicted 1072
4 SASI_Rn01_00067462 predicted 198
5 SASI_Rn01_00067463 predicted 903
6 SASI_Rn01_00067464 predicted 662
7 SASI_Rn01_00067465 predicted 760
8 SASI_Rn01_00067467 predicted 727
9 SASI_Rn01_00067468 predicted 364
10 SASI_Rn02_00268962 predicted 895
11 SASI_Rn01_00067466 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193051 predicted 532
2 SASI_Mm01_00193052 predicted 713
3 SASI_Mm01_00193053 predicted 669
4 SASI_Mm01_00193054 predicted 839
5 SASI_Mm01_00193055 predicted 1002
6 SASI_Mm01_00193056 predicted 662
7 SASI_Mm01_00193057 predicted 813
8 SASI_Mm01_00193058 predicted 472
9 SASI_Mm01_00193059 predicted 744
10 SASI_Mm01_00193060 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136562 predicted 456
2 SASI_Mm01_00136563 predicted 380
3 SASI_Mm01_00136564 predicted 594
4 SASI_Mm01_00136565 predicted 571
5 SASI_Mm01_00136567 predicted 540
6 SASI_Mm01_00136568 predicted 389
7 SASI_Mm01_00136569 predicted 301
8 SASI_Mm01_00136570 predicted 531
9 SASI_Mm01_00136571 predicted 548
10 SASI_Mm02_00336844 predicted 556
11 SASI_Mm01_00136566 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030686
VALIDATED
DHRS4 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-174s21c1
Sequence:CCGGGTTGGACTCAAGCGTGGATGTCTCGAGACATCCACGCTTGAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-391s21c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-792s21c1
Sequence:CCGGCATGAACCCTAACCTACACAACTCGAGTTGTGTAGGTTAGGGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-108s21c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-444s21c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-391s1c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-521s1c1
Sequence:CCGGGTGGTGATTGTGGGTTCTGTACTCGAGTACAGAACCCACAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-108s1c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-444s1c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030686.1-606s1c1
Sequence:CCGGCAACTGCCCAAAGATGTATTTCTCGAGAAATACATCTTTGGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030686
VALIDATED
DHRS4 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-174s21c1
Sequence:CCGGGTTGGACTCAAGCGTGGATGTCTCGAGACATCCACGCTTGAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-391s21c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-792s21c1
Sequence:CCGGCATGAACCCTAACCTACACAACTCGAGTTGTGTAGGTTAGGGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-108s21c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-444s21c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-391s1c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-521s1c1
Sequence:CCGGGTGGTGATTGTGGGTTCTGTACTCGAGTACAGAACCCACAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-108s1c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-444s1c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030686.1-606s1c1
Sequence:CCGGCAACTGCCCAAAGATGTATTTCTCGAGAAATACATCTTTGGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030686
VALIDATED
DHRS4 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-174s21c1
Sequence:CCGGGTTGGACTCAAGCGTGGATGTCTCGAGACATCCACGCTTGAGTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-391s21c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.2-792s21c1
Sequence:CCGGCATGAACCCTAACCTACACAACTCGAGTTGTGTAGGTTAGGGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-108s21c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_030686.1-444s21c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-391s1c1
Sequence:CCGGCCCTTTCTTTGGAAATCTAATCTCGAGATTAGATTTCCAAAGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-521s1c1
Sequence:CCGGGTGGTGATTGTGGGTTCTGTACTCGAGTACAGAACCCACAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-108s1c1
Sequence:CCGGGTCGAAACCCTCTCTCCAATACTCGAGTATTGGAGAGAGGGTTTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030686.1-444s1c1
Sequence:CCGGTGAGCATTAATGTGACAGCTACTCGAGTAGCTGTCACATTAATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030686.1-606s1c1
Sequence:CCGGCAACTGCCCAAAGATGTATTTCTCGAGAAATACATCTTTGGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021004
VALIDATED
DHRS4 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-606s1c1
Sequence:CCGGCCTGACCAAGACCCTGGCCATCTCGAGATGGCCAGGGTCTTGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-660s1c1
Sequence:CCGGCCTAGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-729s1c1
Sequence:CCGGCATGAAAGAAACCCTGCGGATCTCGAGATCCGCAGGGTTTCTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-562s1c1
Sequence:CCGGCCTGGCTTCAGTCCTTACAATCTCGAGATTGTAAGGACTGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-393s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCATAATCTCGAGATTATGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021004
VALIDATED
DHRS4 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-606s1c1
Sequence:CCGGCCTGACCAAGACCCTGGCCATCTCGAGATGGCCAGGGTCTTGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-660s1c1
Sequence:CCGGCCTAGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-729s1c1
Sequence:CCGGCATGAAAGAAACCCTGCGGATCTCGAGATCCGCAGGGTTTCTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-562s1c1
Sequence:CCGGCCTGGCTTCAGTCCTTACAATCTCGAGATTGTAAGGACTGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-393s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCATAATCTCGAGATTATGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021004
VALIDATED
DHRS4 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-606s1c1
Sequence:CCGGCCTGACCAAGACCCTGGCCATCTCGAGATGGCCAGGGTCTTGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021004.2-660s1c1
Sequence:CCGGCCTAGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-729s1c1
Sequence:CCGGCATGAAAGAAACCCTGCGGATCTCGAGATCCGCAGGGTTTCTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-562s1c1
Sequence:CCGGCCTGGCTTCAGTCCTTACAATCTCGAGATTGTAAGGACTGAAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021004.2-393s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCATAATCTCGAGATTATGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks