EMAIL THIS PAGE TO A FRIEND

DHRS4L2

dehydrogenase/reductase (SDR family) member 4 like 2

35 Gene Product Result for
Synonyms: SDR25C3
Species: Human DHRS4L2(317749)
UniProtKB ID: Q6PKH6, Q3YLD4
Gene ID:
Human(317749) Summary: This gene encodes a member of the short chain dehydrogenase reductase family. The encoded protein may be an NADPH dependent retinol oxidoreductase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198083 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198083 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225227 predicted 529
2 SASI_Hs01_00225229 predicted 610
3 SASI_Hs02_00371637 predicted 488
4 SASI_Hs01_00225233 predicted 494
5 SASI_Hs02_00371638 predicted 860
6 SASI_Hs02_00371639 predicted 449
7 SASI_Hs02_00371640 predicted 531
8 SASI_Hs02_00371641 predicted 443
9 SASI_Hs02_00371642 predicted 525
10 SASI_Hs02_00371643 predicted 595
11 SASI_Hs01_00225224 predicted 597
12 SASI_Hs01_00225225 predicted 971
13 SASI_Hs01_00225226 predicted 966
14 SASI_Hs01_00225228 predicted 573
15 SASI_Hs01_00225230 predicted 964
16 SASI_Hs01_00225231 predicted 575
17 SASI_Hs01_00225232 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198083
VALIDATED
DHRS4L2 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 4 like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-869s21c1
Sequence:CCGGATTGTGCTGGCATCGTGTCTTCTCGAGAAGACACGATGCCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198083.2-1059s21c1
Sequence:CCGGTTACTGTTCACCTCATCAAATCTCGAGATTTGATGAGGTGAACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-533s21c1
Sequence:CCGGGACAAGACTCTGGACATTAATCTCGAGATTAATGTCCAGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-387s1c1
Sequence:CCGGGCTGCTGTCAACCCTTTCTTTCTCGAGAAAGAAAGGGTTGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198083.1-641s1c1
Sequence:CCGGCCCAAGGAACATTAGGGTGAACTCGAGTTCACCCTAATGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198083.1-964s1c1
Sequence:CCGGACCTTACTGTTCACCTCATAACTCGAGTTATGAGGTGAACAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-664s1c1
Sequence:CCGGGCCTGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-398s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCCTAATCTCGAGATTAGGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198083
VALIDATED
DHRS4L2 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 4 like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-869s21c1
Sequence:CCGGATTGTGCTGGCATCGTGTCTTCTCGAGAAGACACGATGCCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198083.2-1059s21c1
Sequence:CCGGTTACTGTTCACCTCATCAAATCTCGAGATTTGATGAGGTGAACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-533s21c1
Sequence:CCGGGACAAGACTCTGGACATTAATCTCGAGATTAATGTCCAGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-387s1c1
Sequence:CCGGGCTGCTGTCAACCCTTTCTTTCTCGAGAAAGAAAGGGTTGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198083.1-641s1c1
Sequence:CCGGCCCAAGGAACATTAGGGTGAACTCGAGTTCACCCTAATGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198083.1-964s1c1
Sequence:CCGGACCTTACTGTTCACCTCATAACTCGAGTTATGAGGTGAACAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-664s1c1
Sequence:CCGGGCCTGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-398s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCCTAATCTCGAGATTAGGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198083
VALIDATED
DHRS4L2 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 4 like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-869s21c1
Sequence:CCGGATTGTGCTGGCATCGTGTCTTCTCGAGAAGACACGATGCCAGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198083.2-1059s21c1
Sequence:CCGGTTACTGTTCACCTCATCAAATCTCGAGATTTGATGAGGTGAACAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198083.2-533s21c1
Sequence:CCGGGACAAGACTCTGGACATTAATCTCGAGATTAATGTCCAGAGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-387s1c1
Sequence:CCGGGCTGCTGTCAACCCTTTCTTTCTCGAGAAAGAAAGGGTTGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198083.1-641s1c1
Sequence:CCGGCCCAAGGAACATTAGGGTGAACTCGAGTTCACCCTAATGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198083.1-964s1c1
Sequence:CCGGACCTTACTGTTCACCTCATAACTCGAGTTATGAGGTGAACAGTAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-664s1c1
Sequence:CCGGGCCTGCACCTGGACTTATCAACTCGAGTTGATAAGTCCAGGTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198083.1-398s1c1
Sequence:CCGGCCCTTTCTTTGGAAGCCTAATCTCGAGATTAGGCTTCCAAAGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks