EMAIL THIS PAGE TO A FRIEND

DHRS7B

dehydrogenase/reductase (SDR family) member 7B

56 Gene Product Result for
Synonyms: SDR32C1
UniProtKB ID: Q6IAN0, B5MEF4, Q6UX59, Q9BTF9, Q9UFM6, Q9Y3A1
Gene ID:
Human(25979) Summary: This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
Mouse(216820) dehydrogenase/reductase (SDR family) member 7B
Rat(287380) dehydrogenase/reductase (SDR family) member 7B
domestic guinea pig(100728786) dehydrogenase/reductase (SDR family) member 7B
naked mole-rat(101715567) dehydrogenase/reductase (SDR family) member 7B
sheep(101114453) dehydrogenase/reductase (SDR family) member 7B
Zebrafish(550454) dehydrogenase/reductase (SDR family) member 7B
cow(522283) dehydrogenase/reductase (SDR family) member 7B
domestic cat(101089810) dehydrogenase/reductase (SDR family) member 7B
dog(479531) dehydrogenase/reductase (SDR family) member 7B
chicken(416499) dehydrogenase/reductase (SDR family) member 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015510 Rosetta Predictions human pricing
NM_001008507 Rosetta Predictions rat pricing
NM_145428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044230 predicted 1063
2 SASI_Hs01_00044231 predicted 406
3 SASI_Hs01_00044232 predicted 234
4 SASI_Hs01_00044233 predicted 288
5 SASI_Hs01_00044235 predicted 427
6 SASI_Hs01_00044236 predicted 1080
7 SASI_Hs01_00044237 predicted 995
8 SASI_Hs01_00044238 predicted 230
9 SASI_Hs02_00347995 predicted 499
10 SASI_Hs01_00044239 predicted 521
11 SASI_Hs01_00044234 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038521 predicted 693
2 SASI_Rn01_00038523 predicted 596
3 SASI_Rn01_00038524 predicted 397
4 SASI_Rn01_00038526 predicted 896
5 SASI_Rn01_00038528 predicted 354
6 SASI_Rn01_00038529 predicted 714
7 SASI_Rn01_00038530 predicted 284
8 SASI_Rn02_00199177 predicted 683
9 SASI_Rn02_00199178 predicted 384
10 SASI_Rn02_00199179 predicted 730
11 SASI_Rn01_00038522 predicted 894
12 SASI_Rn01_00038525 predicted 409
13 SASI_Rn01_00038527 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189699 predicted 741
2 SASI_Mm01_00189700 predicted 756
3 SASI_Mm01_00189701 predicted 748
4 SASI_Mm02_00340781 predicted 308
5 SASI_Mm01_00189703 predicted 915
6 SASI_Mm01_00189704 predicted 451
7 SASI_Mm01_00189705 predicted 699
8 SASI_Mm01_00189706 predicted 781
9 SASI_Mm01_00189707 predicted 426
10 SASI_Mm01_00189708 predicted 521
11 SASI_Mm01_00189702 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015510
VALIDATED
DHRS7B MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-695s21c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-984s21c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015510.3-1082s21c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-339s21c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-1082s1c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-695s1c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-984s1c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015510.3-339s1c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-216s1c1
Sequence:CCGGGCTGGGCAAAGAATGTGCAAACTCGAGTTTGCACATTCTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015510
VALIDATED
DHRS7B MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-695s21c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-984s21c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015510.3-1082s21c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-339s21c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-1082s1c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-695s1c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-984s1c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015510.3-339s1c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-216s1c1
Sequence:CCGGGCTGGGCAAAGAATGTGCAAACTCGAGTTTGCACATTCTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015510
VALIDATED
DHRS7B MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-695s21c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-984s21c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015510.3-1082s21c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015510.3-339s21c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-1082s1c1
Sequence:CCGGGTTGAGACTTTAATGGAGATTCTCGAGAATCTCCATTAAAGTCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-695s1c1
Sequence:CCGGCCGAGATGGAACAGTATGAAACTCGAGTTTCATACTGTTCCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-984s1c1
Sequence:CCGGGCGGAAATCCAAGAACTCCTACTCGAGTAGGAGTTCTTGGATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_015510.3-339s1c1
Sequence:CCGGGCAGACACACAAGCCTTACTTCTCGAGAAGTAAGGCTTGTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015510.3-216s1c1
Sequence:CCGGGCTGGGCAAAGAATGTGCAAACTCGAGTTTGCACATTCTTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145428
VALIDATED
DHRS7B MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7B
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-672s1c1
Sequence:CCGGCCAGGCATTCTTTGACTGTCTCTCGAGAGACAGTCAAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145428.1-743s1c1
Sequence:CCGGGCTACATCCATACCAACCTCTCTCGAGAGAGGTTGGTATGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145428.1-886s1c1
Sequence:CCGGGATGTTCTCCTGACAGACTTTCTCGAGAAAGTCTGTCAGGAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-520s1c1
Sequence:CCGGGAAATAAACTACTTTGGCCCTCTCGAGAGGGCCAAAGTAGTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-897s1c1
Sequence:CCGGGACAGACTTTGTGCCATCCATCTCGAGATGGATGGCACAAAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-480s1c1
Sequence:CCGGCATTAGTGATACCATAGTGGACTCGAGTCCACTATGGTATCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145428
VALIDATED
DHRS7B MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7B
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-672s1c1
Sequence:CCGGCCAGGCATTCTTTGACTGTCTCTCGAGAGACAGTCAAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145428.1-743s1c1
Sequence:CCGGGCTACATCCATACCAACCTCTCTCGAGAGAGGTTGGTATGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145428.1-886s1c1
Sequence:CCGGGATGTTCTCCTGACAGACTTTCTCGAGAAAGTCTGTCAGGAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-520s1c1
Sequence:CCGGGAAATAAACTACTTTGGCCCTCTCGAGAGGGCCAAAGTAGTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-897s1c1
Sequence:CCGGGACAGACTTTGTGCCATCCATCTCGAGATGGATGGCACAAAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-480s1c1
Sequence:CCGGCATTAGTGATACCATAGTGGACTCGAGTCCACTATGGTATCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145428
VALIDATED
DHRS7B MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7B
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-672s1c1
Sequence:CCGGCCAGGCATTCTTTGACTGTCTCTCGAGAGACAGTCAAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145428.1-743s1c1
Sequence:CCGGGCTACATCCATACCAACCTCTCTCGAGAGAGGTTGGTATGGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145428.1-886s1c1
Sequence:CCGGGATGTTCTCCTGACAGACTTTCTCGAGAAAGTCTGTCAGGAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-520s1c1
Sequence:CCGGGAAATAAACTACTTTGGCCCTCTCGAGAGGGCCAAAGTAGTTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-897s1c1
Sequence:CCGGGACAGACTTTGTGCCATCCATCTCGAGATGGATGGCACAAAGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145428.1-480s1c1
Sequence:CCGGCATTAGTGATACCATAGTGGACTCGAGTCCACTATGGTATCACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks