EMAIL THIS PAGE TO A FRIEND

DHRS7C

dehydrogenase/reductase (SDR family) member 7C

63 Gene Product Result for
Synonyms: SDR32C2
UniProtKB ID: A6NNS2, B7ZW74
Gene ID:
Mouse(68460) dehydrogenase/reductase (SDR family) member 7C
Rat(287411) dehydrogenase/reductase (SDR family) member 7C
Zebrafish(553684) dehydrogenase/reductase (SDR family) member 7C
cow(511943) dehydrogenase/reductase (SDR family) member 7C
domestic cat(101084145) dehydrogenase/reductase (SDR family) member 7C
dog(479501) dehydrogenase/reductase (SDR family) member 7C
chicken(417304) dehydrogenase/reductase (SDR family) member 7C
sheep(101110775) dehydrogenase/reductase (SDR family) member 7C
naked mole-rat(101724948) dehydrogenase/reductase (SDR family) member 7C
domestic guinea pig(100725185) dehydrogenase/reductase (SDR family) member 7C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010041 MISSION® esiRNA esiRNA targeting human DHRS7C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105571 Rosetta Predictions human pricing
XM_113912 Rosetta Predictions human pricing
XM_001078936 Rosetta Predictions rat pricing
XM_213343 Rosetta Predictions rat pricing
NM_001013013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324511 predicted 466
2 SASI_Hs02_00324512 predicted 331
3 SASI_Hs02_00324513 predicted 619
4 SASI_Hs02_00324514 predicted 667
5 SASI_Hs02_00324515 predicted 743
6 SASI_Hs02_00324516 predicted 276
7 SASI_Hs02_00324517 predicted 538
8 SASI_Hs02_00324518 predicted 500
9 SASI_Hs02_00324519 predicted 659
10 SASI_Hs02_00324520 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_113912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291725 predicted 332
2 SASI_Hs01_00291726 predicted 617
3 SASI_Hs01_00291727 predicted 671
4 SASI_Hs01_00291728 predicted 733
5 SASI_Hs01_00291729 predicted 684
6 SASI_Hs01_00291730 predicted 348
7 SASI_Hs01_00291731 predicted 267
8 SASI_Hs01_00291732 predicted 535
9 SASI_Hs01_00291733 predicted 497
10 SASI_Hs01_00291734 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362550 predicted 766
2 SASI_Rn02_00362551 predicted 212
3 SASI_Rn02_00362552 predicted 563
4 SASI_Rn02_00362553 predicted 458
5 SASI_Rn02_00362554 predicted 419
6 SASI_Rn02_00362555 predicted 807
7 SASI_Rn02_00362556 predicted 738
8 SASI_Rn02_00362557 predicted 715
9 SASI_Rn02_00362558 predicted 581
10 SASI_Rn02_00362559 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374549 predicted 770
2 SASI_Rn02_00374550 predicted 780
3 SASI_Rn02_00374551 predicted 804
4 SASI_Rn02_00374552 predicted 798
5 SASI_Rn02_00374553 predicted 727
6 SASI_Rn02_00374554 predicted 866
7 SASI_Rn02_00374555 predicted 738
8 SASI_Rn02_00374556 predicted 704
9 SASI_Rn02_00374557 predicted 785
10 SASI_Rn02_00374558 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097862 predicted 575
2 SASI_Mm01_00097863 predicted 494
3 SASI_Mm01_00097864 predicted 696
4 SASI_Mm01_00097866 predicted 438
5 SASI_Mm01_00097867 predicted 596
6 SASI_Mm01_00097868 predicted 726
7 SASI_Mm02_00287139 predicted 212
8 SASI_Mm01_00097869 predicted 672
9 SASI_Mm01_00097870 predicted 651
10 SASI_Mm02_00287140 predicted 245
11 SASI_Mm01_00097865 predicted 734
12 SASI_Mm01_00097871 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013013
DHRS7C MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7C
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-598s1c1
Sequence:CCGGGCTTATGCAGCTTCTAAGCATCTCGAGATGCTTAGAAGCTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-399s1c1
Sequence:CCGGCATCAACAATGCCAGCGTGAACTCGAGTTCACGCTGGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-441s1c1
Sequence:CCGGGATTTCCCTGGAGCTTGACAACTCGAGTTGTCAAGCTCCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-465s1c1
Sequence:CCGGGATCATGGATGCCAACTACTTCTCGAGAAGTAGTTGGCATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.1-564s1c1
Sequence:CCGGCATCCAAGCGAAGTTTGGAATCTCGAGATTCCAAACTTCGCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-443s1c1
Sequence:CCGGGACATTAGCTGTGTTCAAGATCTCGAGATCTTGAACACAGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-763s1c1
Sequence:CCGGGGTTGAGGAATACGATGTTGTCTCGAGACAACATCGTATTCCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013013
DHRS7C MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7C
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-598s1c1
Sequence:CCGGGCTTATGCAGCTTCTAAGCATCTCGAGATGCTTAGAAGCTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-399s1c1
Sequence:CCGGCATCAACAATGCCAGCGTGAACTCGAGTTCACGCTGGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-441s1c1
Sequence:CCGGGATTTCCCTGGAGCTTGACAACTCGAGTTGTCAAGCTCCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-465s1c1
Sequence:CCGGGATCATGGATGCCAACTACTTCTCGAGAAGTAGTTGGCATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.1-564s1c1
Sequence:CCGGCATCCAAGCGAAGTTTGGAATCTCGAGATTCCAAACTTCGCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-443s1c1
Sequence:CCGGGACATTAGCTGTGTTCAAGATCTCGAGATCTTGAACACAGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-763s1c1
Sequence:CCGGGGTTGAGGAATACGATGTTGTCTCGAGACAACATCGTATTCCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013013
DHRS7C MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7C
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-598s1c1
Sequence:CCGGGCTTATGCAGCTTCTAAGCATCTCGAGATGCTTAGAAGCTGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-399s1c1
Sequence:CCGGCATCAACAATGCCAGCGTGAACTCGAGTTCACGCTGGCATTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-441s1c1
Sequence:CCGGGATTTCCCTGGAGCTTGACAACTCGAGTTGTCAAGCTCCAGGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013013.1-465s1c1
Sequence:CCGGGATCATGGATGCCAACTACTTCTCGAGAAGTAGTTGGCATCCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.1-564s1c1
Sequence:CCGGCATCCAAGCGAAGTTTGGAATCTCGAGATTCCAAACTTCGCTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-443s1c1
Sequence:CCGGGACATTAGCTGTGTTCAAGATCTCGAGATCTTGAACACAGCTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013013.2-763s1c1
Sequence:CCGGGGTTGAGGAATACGATGTTGTCTCGAGACAACATCGTATTCCTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105571
DHRS7C MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 7C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-701s21c1
Sequence:CCGGGAAACTGGGAAGCTTCCATTTCTCGAGAAATGGAAGCTTCCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-801s21c1
Sequence:CCGGGAAGAAGCAAGAGGTGTTTATCTCGAGATAAACACCTCTTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-506s21c1
Sequence:CCGGGAACAGGCCAAATCGTGTTAGCTCGAGCTAACACGATTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-215s21c1
Sequence:CCGGAGAGGCTAGAGAACCTATATGCTCGAGCATATAGGTTCTCTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-553s21c1
Sequence:CCGGATCCCGTTCCGTACGACTTACCTCGAGGTAAGTCGTACGGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105571
DHRS7C MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 7C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-701s21c1
Sequence:CCGGGAAACTGGGAAGCTTCCATTTCTCGAGAAATGGAAGCTTCCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-801s21c1
Sequence:CCGGGAAGAAGCAAGAGGTGTTTATCTCGAGATAAACACCTCTTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-506s21c1
Sequence:CCGGGAACAGGCCAAATCGTGTTAGCTCGAGCTAACACGATTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-215s21c1
Sequence:CCGGAGAGGCTAGAGAACCTATATGCTCGAGCATATAGGTTCTCTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-553s21c1
Sequence:CCGGATCCCGTTCCGTACGACTTACCTCGAGGTAAGTCGTACGGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105571
DHRS7C MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 7C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-701s21c1
Sequence:CCGGGAAACTGGGAAGCTTCCATTTCTCGAGAAATGGAAGCTTCCCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-801s21c1
Sequence:CCGGGAAGAAGCAAGAGGTGTTTATCTCGAGATAAACACCTCTTGCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-506s21c1
Sequence:CCGGGAACAGGCCAAATCGTGTTAGCTCGAGCTAACACGATTTGGCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-215s21c1
Sequence:CCGGAGAGGCTAGAGAACCTATATGCTCGAGCATATAGGTTCTCTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105571.1-553s21c1
Sequence:CCGGATCCCGTTCCGTACGACTTACCTCGAGGTAAGTCGTACGGAACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks