EMAIL THIS PAGE TO A FRIEND

DHRS9

dehydrogenase/reductase (SDR family) member 9

72 Gene Product Result for
Synonyms: 3ALPHA-HSD RDH-TBE RDH15 RDHL RDHTBE RETSDR8 SDR9C4
UniProtKB ID: Q9BPW9, D3DPC1, Q5RKX1, Q9NRA9, Q9NRB0
Gene ID:
Mouse(241452) dehydrogenase/reductase (SDR family) member 9
Rat(170635) dehydrogenase/reductase (SDR family) member 9
Zebrafish(322529) dehydrogenase/reductase (SDR family) member 9
dog(488391) dehydrogenase/reductase (SDR family) member 9
cow(282851) dehydrogenase/reductase (SDR family) member 9
domestic cat(101085993) dehydrogenase/reductase (SDR family) member 9
domestic guinea pig(100735876) dehydrogenase/reductase (SDR family) member 9
naked mole-rat(101716890) dehydrogenase/reductase (SDR family) member 9
sheep(101120807) dehydrogenase/reductase (SDR family) member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005771 Rosetta Predictions human pricing
NM_199204 Rosetta Predictions human pricing
NM_130819 Rosetta Predictions rat pricing
NM_175512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217749 predicted 2490
2 SASI_Hs01_00217750 predicted 1858
3 SASI_Hs01_00217751 predicted 2544
4 SASI_Hs01_00217752 predicted 1897
5 SASI_Hs01_00217753 predicted 1865
6 SASI_Hs01_00217754 predicted 1897
7 SASI_Hs01_00217755 predicted 2559
8 SASI_Hs01_00217756 predicted 2564
9 SASI_Hs01_00217757 predicted 2488
10 SASI_Hs02_00340247 predicted 1892
11 SASI_Hs01_00217758 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163996 predicted 1541
2 SASI_Hs01_00163997 predicted 910
3 SASI_Hs01_00163998 predicted 1599
4 SASI_Hs01_00163999 predicted 949
5 SASI_Hs01_00164000 predicted 913
6 SASI_Hs01_00164001 predicted 946
7 SASI_Hs01_00164002 predicted 1605
8 SASI_Hs01_00164003 predicted 1617
9 SASI_Hs01_00164004 predicted 1537
10 SASI_Hs02_00372660 predicted 948
11 SASI_Hs01_00164005 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081245 predicted 589
2 SASI_Rn01_00081246 predicted 247
3 SASI_Rn02_00267511 predicted 819
4 SASI_Rn01_00081247 predicted 568
5 SASI_Rn02_00267512 predicted 1056
6 SASI_Rn01_00081248 predicted 1218
7 SASI_Rn01_00081249 predicted 1023
8 SASI_Rn01_00081250 predicted 1230
9 SASI_Rn01_00081252 predicted 1185
10 SASI_Rn01_00081253 predicted 666
11 SASI_Rn01_00081251 predicted 346
12 SASI_Rn01_00081254 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199755 predicted 655
2 SASI_Mm01_00199756 predicted 622
3 SASI_Mm01_00199757 predicted 1433
4 SASI_Mm01_00199758 predicted 292
5 SASI_Mm01_00199759 predicted 282
6 SASI_Mm01_00199760 predicted 1287
7 SASI_Mm01_00199761 predicted 1213
8 SASI_Mm01_00199762 predicted 1375
9 SASI_Mm01_00199763 predicted 622
10 SASI_Mm01_00199764 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005771
DHRS9 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1886s21c1
Sequence:CCGGAGGACTACAGAGAACCTATTGCTCGAGCAATAGGTTCTCTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2026s21c1
Sequence:GTACCGGGGCTATACTCCATCCAAATATCTCGAGATATTTGGATGGAGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1925s21c1
Sequence:CCGGTCATCAGTGTGACACTAAATACTCGAGTATTTAGTGTCACACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005771.3-2491s21c1
Sequence:CCGGGGCTATGAAATTGGCCGATTTCTCGAGAAATCGGCCAATTTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2143s21c1
Sequence:GTACCGGGCAGATCCAGTAAAGGTAATTCTCGAGAATTACCTTTACTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2035s1c1
Sequence:CCGGCCATCCAAATATGCAGTGGAACTCGAGTTCCACTGCATATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2395s1c1
Sequence:CCGGCCAGCAGCTTTGCAAGACTTTCTCGAGAAAGTCTTGCAAAGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2310s1c1
Sequence:CCGGCCACGCTCTAACAAGTCTCTTCTCGAGAAGAGACTTGTTAGAGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1900s1c1
Sequence:CCGGCCTATTGAAGTGAACCTGTTTCTCGAGAAACAGGTTCACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1951s1c1
Sequence:CCGGCCTTTGGTCAAGAAAGCTCAACTCGAGTTGAGCTTTCTTGACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005771
DHRS9 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1886s21c1
Sequence:CCGGAGGACTACAGAGAACCTATTGCTCGAGCAATAGGTTCTCTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2026s21c1
Sequence:GTACCGGGGCTATACTCCATCCAAATATCTCGAGATATTTGGATGGAGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1925s21c1
Sequence:CCGGTCATCAGTGTGACACTAAATACTCGAGTATTTAGTGTCACACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005771.3-2491s21c1
Sequence:CCGGGGCTATGAAATTGGCCGATTTCTCGAGAAATCGGCCAATTTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2143s21c1
Sequence:GTACCGGGCAGATCCAGTAAAGGTAATTCTCGAGAATTACCTTTACTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2035s1c1
Sequence:CCGGCCATCCAAATATGCAGTGGAACTCGAGTTCCACTGCATATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2395s1c1
Sequence:CCGGCCAGCAGCTTTGCAAGACTTTCTCGAGAAAGTCTTGCAAAGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2310s1c1
Sequence:CCGGCCACGCTCTAACAAGTCTCTTCTCGAGAAGAGACTTGTTAGAGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1900s1c1
Sequence:CCGGCCTATTGAAGTGAACCTGTTTCTCGAGAAACAGGTTCACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1951s1c1
Sequence:CCGGCCTTTGGTCAAGAAAGCTCAACTCGAGTTGAGCTTTCTTGACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005771
DHRS9 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1886s21c1
Sequence:CCGGAGGACTACAGAGAACCTATTGCTCGAGCAATAGGTTCTCTGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2026s21c1
Sequence:GTACCGGGGCTATACTCCATCCAAATATCTCGAGATATTTGGATGGAGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-1925s21c1
Sequence:CCGGTCATCAGTGTGACACTAAATACTCGAGTATTTAGTGTCACACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005771.3-2491s21c1
Sequence:CCGGGGCTATGAAATTGGCCGATTTCTCGAGAAATCGGCCAATTTCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005771.3-2143s21c1
Sequence:GTACCGGGCAGATCCAGTAAAGGTAATTCTCGAGAATTACCTTTACTGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2035s1c1
Sequence:CCGGCCATCCAAATATGCAGTGGAACTCGAGTTCCACTGCATATTTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2395s1c1
Sequence:CCGGCCAGCAGCTTTGCAAGACTTTCTCGAGAAAGTCTTGCAAAGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-2310s1c1
Sequence:CCGGCCACGCTCTAACAAGTCTCTTCTCGAGAAGAGACTTGTTAGAGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1900s1c1
Sequence:CCGGCCTATTGAAGTGAACCTGTTTCTCGAGAAACAGGTTCACTTCAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005771.3-1951s1c1
Sequence:CCGGCCTTTGGTCAAGAAAGCTCAACTCGAGTTGAGCTTTCTTGACCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175512
DHRS9 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-625s1c1
Sequence:CCGGCCCATTGAAGTTAACCTGTTTCTCGAGAAACAGGTTAACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-353s1c1
Sequence:CCGGGAAACTTAGCAGCCAGAACTTCTCGAGAAGTTCTGGCTGCTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-1087s1c1
Sequence:CCGGGCCAAGACATTCTGGATACCTCTCGAGAGGTATCCAGAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-871s1c1
Sequence:CCGGGATCCAATCAAGACAACTGAACTCGAGTTCAGTTGTCTTGATTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-289s1c1
Sequence:CCGGCAGTTGAAGATAGCAGACATTCTCGAGAATGTCTGCTATCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175512
DHRS9 MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-625s1c1
Sequence:CCGGCCCATTGAAGTTAACCTGTTTCTCGAGAAACAGGTTAACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-353s1c1
Sequence:CCGGGAAACTTAGCAGCCAGAACTTCTCGAGAAGTTCTGGCTGCTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-1087s1c1
Sequence:CCGGGCCAAGACATTCTGGATACCTCTCGAGAGGTATCCAGAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-871s1c1
Sequence:CCGGGATCCAATCAAGACAACTGAACTCGAGTTCAGTTGTCTTGATTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-289s1c1
Sequence:CCGGCAGTTGAAGATAGCAGACATTCTCGAGAATGTCTGCTATCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175512
DHRS9 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-625s1c1
Sequence:CCGGCCCATTGAAGTTAACCTGTTTCTCGAGAAACAGGTTAACTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-353s1c1
Sequence:CCGGGAAACTTAGCAGCCAGAACTTCTCGAGAAGTTCTGGCTGCTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-1087s1c1
Sequence:CCGGGCCAAGACATTCTGGATACCTCTCGAGAGGTATCCAGAATGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-871s1c1
Sequence:CCGGGATCCAATCAAGACAACTGAACTCGAGTTCAGTTGTCTTGATTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175512.2-289s1c1
Sequence:CCGGCAGTTGAAGATAGCAGACATTCTCGAGAATGTCTGCTATCTTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks