EMAIL THIS PAGE TO A FRIEND

DHRSX

dehydrogenase/reductase (SDR family) X-linked

48 Gene Product Result for
Synonyms: CXorf11 DHRS5X DHRS5Y DHRSXY DHRSY SDR46C1
UniProtKB ID: Q8N5I4, Q6UWC7, Q8WUS4, Q96GR8, Q9NTF6
Gene ID:
Mouse(236082) dehydrogenase/reductase (SDR family) X chromosome
Rat(288525) dehydrogenase/reductase (SDR family) X-linked
sheep(101115005) dehydrogenase/reductase (SDR family) X-linked
naked mole-rat(101705890) dehydrogenase/reductase (SDR family) X-linked
Zebrafish(100318301) dehydrogenase/reductase (SDR family) X-linked
chicken(428007) dehydrogenase/reductase (SDR family) X-linked
dog(609792) dehydrogenase/reductase (SDR family) X-linked
cow(513482) dehydrogenase/reductase (SDR family) X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170841 MISSION® esiRNA esiRNA targeting mouse Dhrsx mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145177 Rosetta Predictions human pricing
NM_001105914 Rosetta Predictions rat pricing
NM_001033326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168790 predicted 1000
2 SASI_Hs01_00168791 predicted 558
3 SASI_Hs01_00168792 predicted 1027
4 SASI_Hs01_00168793 predicted 238
5 SASI_Hs01_00168794 predicted 336
6 SASI_Hs01_00168795 predicted 273
7 SASI_Hs01_00168796 predicted 1211
8 SASI_Hs01_00168797 predicted 1233
9 SASI_Hs01_00168798 predicted 814
10 SASI_Hs01_00168799 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213782 predicted 219
2 SASI_Rn02_00213783 predicted 313
3 SASI_Rn02_00213784 predicted 303
4 SASI_Rn02_00213785 predicted 374
5 SASI_Rn02_00213786 predicted 500
6 SASI_Rn02_00213787 predicted 256
7 SASI_Rn02_00213788 predicted 407
8 SASI_Rn02_00213789 predicted 441
9 SASI_Rn02_00213790 predicted 265
10 SASI_Rn02_00213791 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288567 predicted 862
2 SASI_Mm01_00194382 predicted 1560
3 SASI_Mm01_00194379 predicted 1746
4 SASI_Mm01_00194383 predicted 1065
5 SASI_Mm02_00288568 predicted 504
6 SASI_Mm01_00194384 predicted 1419
7 SASI_Mm02_00288569 predicted 445
8 SASI_Mm02_00288570 predicted 876
9 SASI_Mm01_00194385 predicted 828
10 SASI_Mm01_00194388 predicted 969
11 SASI_Mm01_00194380 predicted 1275
12 SASI_Mm01_00194381 predicted 566
13 SASI_Mm01_00194386 predicted 877
14 SASI_Mm01_00194387 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145177
VALIDATED
DHRSX MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-489s1c1
Sequence:CCGGCCTTCTCTTGGATACGCTGAACTCGAGTTCAGCGTATCCAAGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-213s1c1
Sequence:CCGGGCATGTTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-247s1c1
Sequence:CCGGGCCAAACAAGTTGTAAGCAAACTCGAGTTTGCTTACAACTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-954s1c1
Sequence:CCGGGTGGTCTAAGAGTTGTGAGATCTCGAGATCTCACAACTCTTAGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-882s1c1
Sequence:CCGGCCGTTACCTATACAACGAGAACTCGAGTTCTCGTTGTATAGGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-201s21c1
Sequence:CCGGGGACAGATGGCATTGGCTATTCTCGAGAATAGCCAATGCCATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-256s21c1
Sequence:CCGGTGTTATCATAGCTGGAAATAACTCGAGTTATTTCCAGCTATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-366s21c1
Sequence:CCGGTGACTTCCATCCGGCAGTTTGCTCGAGCAAACTGCCGGATGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-924s21c1
Sequence:CCGGATTACCTATACAACGAGAAAGCTCGAGCTTTCTCGTTGTATAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145177.2-1692s21c1
Sequence:CCGGCCTAACCCTCAGAACCTATAACTCGAGTTATAGGTTCTGAGGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145177
VALIDATED
DHRSX MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-489s1c1
Sequence:CCGGCCTTCTCTTGGATACGCTGAACTCGAGTTCAGCGTATCCAAGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-213s1c1
Sequence:CCGGGCATGTTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-247s1c1
Sequence:CCGGGCCAAACAAGTTGTAAGCAAACTCGAGTTTGCTTACAACTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-954s1c1
Sequence:CCGGGTGGTCTAAGAGTTGTGAGATCTCGAGATCTCACAACTCTTAGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-882s1c1
Sequence:CCGGCCGTTACCTATACAACGAGAACTCGAGTTCTCGTTGTATAGGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-201s21c1
Sequence:CCGGGGACAGATGGCATTGGCTATTCTCGAGAATAGCCAATGCCATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-256s21c1
Sequence:CCGGTGTTATCATAGCTGGAAATAACTCGAGTTATTTCCAGCTATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-366s21c1
Sequence:CCGGTGACTTCCATCCGGCAGTTTGCTCGAGCAAACTGCCGGATGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-924s21c1
Sequence:CCGGATTACCTATACAACGAGAAAGCTCGAGCTTTCTCGTTGTATAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145177.2-1692s21c1
Sequence:CCGGCCTAACCCTCAGAACCTATAACTCGAGTTATAGGTTCTGAGGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145177
VALIDATED
DHRSX MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-489s1c1
Sequence:CCGGCCTTCTCTTGGATACGCTGAACTCGAGTTCAGCGTATCCAAGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-213s1c1
Sequence:CCGGGCATGTTATCATAGCTGGAAACTCGAGTTTCCAGCTATGATAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_145177.1-247s1c1
Sequence:CCGGGCCAAACAAGTTGTAAGCAAACTCGAGTTTGCTTACAACTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-954s1c1
Sequence:CCGGGTGGTCTAAGAGTTGTGAGATCTCGAGATCTCACAACTCTTAGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145177.1-882s1c1
Sequence:CCGGCCGTTACCTATACAACGAGAACTCGAGTTCTCGTTGTATAGGTAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-201s21c1
Sequence:CCGGGGACAGATGGCATTGGCTATTCTCGAGAATAGCCAATGCCATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-256s21c1
Sequence:CCGGTGTTATCATAGCTGGAAATAACTCGAGTTATTTCCAGCTATGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-366s21c1
Sequence:CCGGTGACTTCCATCCGGCAGTTTGCTCGAGCAAACTGCCGGATGGAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145177.2-924s21c1
Sequence:CCGGATTACCTATACAACGAGAAAGCTCGAGCTTTCTCGTTGTATAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145177.2-1692s21c1
Sequence:CCGGCCTAACCCTCAGAACCTATAACTCGAGTTATAGGTTCTGAGGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033326
DHRSX MISSION shRNA Bacterial Glycerol Stock
dehydrogenase/reductase (SDR family) X-linked
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-651s21c1
Sequence:CCGGACTGCGGACAGGAAGTTGTCACTCGAGTGACAACTTCCTGTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-1107s21c1
Sequence:CCGGGTGACCCTGTGACCTCCAACACTCGAGTGTTGGAGGTCACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-784s21c1
Sequence:CCGGCCTGCACCTGCTCGTCAACAACTCGAGTTGTTGACGAGCAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-865s21c1
Sequence:CCGGTGTGAACTTCCTGGGCCACTTCTCGAGAAGTGGCCCAGGAAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033326
DHRSX MISSION shRNA shRNA Plasmid DNA
dehydrogenase/reductase (SDR family) X-linked
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-651s21c1
Sequence:CCGGACTGCGGACAGGAAGTTGTCACTCGAGTGACAACTTCCTGTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-1107s21c1
Sequence:CCGGGTGACCCTGTGACCTCCAACACTCGAGTGTTGGAGGTCACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-784s21c1
Sequence:CCGGCCTGCACCTGCTCGTCAACAACTCGAGTTGTTGACGAGCAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-865s21c1
Sequence:CCGGTGTGAACTTCCTGGGCCACTTCTCGAGAAGTGGCCCAGGAAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033326
DHRSX MISSION shRNA Lentiviral Transduction Particles
dehydrogenase/reductase (SDR family) X-linked
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-651s21c1
Sequence:CCGGACTGCGGACAGGAAGTTGTCACTCGAGTGACAACTTCCTGTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-1107s21c1
Sequence:CCGGGTGACCCTGTGACCTCCAACACTCGAGTGTTGGAGGTCACAGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-784s21c1
Sequence:CCGGCCTGCACCTGCTCGTCAACAACTCGAGTTGTTGACGAGCAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033326.2-865s21c1
Sequence:CCGGTGTGAACTTCCTGGGCCACTTCTCGAGAAGTGGCCCAGGAAGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks