EMAIL THIS PAGE TO A FRIEND

DHTKD1

dehydrogenase E1 and transketolase domain containing 1

176 Gene Product Result for
Synonyms: AMOXAD CMT2Q
UniProtKB ID: Q96HY7, Q68CU5, Q9BUM8, Q9HCE2
Gene ID:
Human(55526) Summary: This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Mouse(209692) dehydrogenase E1 and transketolase domain containing 1
Rat(361272) dehydrogenase E1 and transketolase domain containing 1
Zebrafish(494076) dehydrogenase E1 and transketolase domain containing 1
cow(517113) dehydrogenase E1 and transketolase domain containing 1
Horse(100056844) dehydrogenase E1 and transketolase domain containing 1
dog(478008) dehydrogenase E1 and transketolase domain containing 1
domestic cat(101086155) dehydrogenase E1 and transketolase domain containing 1
chicken(426076) dehydrogenase E1 and transketolase domain containing 1
domestic guinea pig(100725295) dehydrogenase E1 and transketolase domain containing 1
naked mole-rat(101721202) dehydrogenase E1 and transketolase domain containing 1
sheep(101117008) dehydrogenase E1 and transketolase domain containing 1
Domestic Rabbit(100356735) dehydrogenase E1 and transketolase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018706 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018706 Rosetta Predictions human pricing
NM_001025720 Rosetta Predictions rat pricing
NM_001081131 Rosetta Predictions mouse pricing
XM_140800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352234 predicted 1114
2 SASI_Hs02_00352235 predicted 2620
3 SASI_Hs01_00232777 predicted 1643
4 SASI_Hs01_00232778 predicted 1869
5 SASI_Hs01_00232779 predicted 421
6 SASI_Hs01_00232780 predicted 1210
7 SASI_Hs02_00352236 predicted 2433
8 SASI_Hs01_00232781 predicted 2344
9 SASI_Hs01_00232782 predicted 466
10 SASI_Hs01_00232783 predicted 1201
11 SASI_Hs01_00232784 predicted 407
12 SASI_Hs01_00232785 predicted 1324
13 SASI_Hs01_00232786 predicted 2258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033025 predicted 435
2 SASI_Rn01_00033026 predicted 1804
3 SASI_Rn01_00033027 predicted 2291
4 SASI_Rn01_00033028 predicted 2617
5 SASI_Rn01_00033029 predicted 2320
6 SASI_Rn01_00033030 predicted 1110
7 SASI_Rn01_00033031 predicted 373
8 SASI_Rn01_00033033 predicted 2717
9 SASI_Rn01_00033034 predicted 2348
10 SASI_Rn02_00203343 predicted 1423
11 SASI_Rn01_00033032 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295491 predicted 477
2 SASI_Mm02_00295492 predicted 2535
3 SASI_Mm02_00295493 predicted 2350
4 SASI_Mm02_00295494 predicted 495
5 SASI_Mm02_00295495 predicted 2973
6 SASI_Mm02_00295496 predicted 662
7 SASI_Mm02_00295497 predicted 2256
8 SASI_Mm02_00295498 predicted 1969
9 SASI_Mm02_00295499 predicted 465
10 SASI_Mm02_00295500 predicted 2717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280064 predicted 485
2 SASI_Mm01_00280065 predicted 2535
3 SASI_Mm01_00280066 predicted 792
4 SASI_Mm01_00280067 predicted 2351
5 SASI_Mm01_00280068 predicted 504
6 SASI_Mm01_00280069 predicted 2979
7 SASI_Mm01_00280070 predicted 668
8 SASI_Mm01_00280071 predicted 2261
9 SASI_Mm01_00280072 predicted 477
10 SASI_Mm01_00280073 predicted 2727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018706
VALIDATED
DHTKD1 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase E1 and transketolase domain containing 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-2082s21c1
Sequence:CCGGGGAGGCACAGTTTGGCGATTTCTCGAGAAATCGCCAAACTGTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-453s21c1
Sequence:CCGGGTTAGTCTATCTCAATCAAATCTCGAGATTTGATTGAGATAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-649s21c1
Sequence:CCGGTTCTCGACAGTGAAGCGATATCTCGAGATATCGCTTCACTGTCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-1354s21c1
Sequence:CCGGTTCCGCAAGGATGTGATTATTCTCGAGAATAATCACATCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-766s21c1
Sequence:CCGGCATAGAGGGAGGCTGAATTTACTCGAGTAAATTCAGCCTCCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-396s21c1
Sequence:CCGGCTTCCACACGGCAGGATTATTCTCGAGAATAATCCTGCCGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-2219s21c1
Sequence:CCGGACCACTCATCCTGTCGAATAGCTCGAGCTATTCGACAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-2023s21c1
Sequence:CCGGGCCGTCCTGGGATTCGAATATCTCGAGATATTCGAATCCCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3291s21c1
Sequence:CCGGTGGGATTGATATACGTGATTTCTCGAGAAATCACGTATATCAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3819s21c1
Sequence:CCGGTGACCCTAATTGACCATATATCTCGAGATATATGGTCAATTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-697s1c1
Sequence:CCGGGCGGGATCACTGATGTCATTACTCGAGTAATGACATCAGTGATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2077s1c1
Sequence:CCGGCCCAGATCATCTTTGACACATCTCGAGATGTGTCAAAGATGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-774s1c1
Sequence:CCGGCCAGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2506s1c1
Sequence:CCGGCCCTGGTGAAACAAAGAGAATCTCGAGATTCTCTTTGTTTCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-231s1c1
Sequence:CCGGGCCAGGTTGGTGACAGTATATCTCGAGATATACTGTCACCAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018706
VALIDATED
DHTKD1 MISSION shRNA shRNA Plasmid DNA
dehydrogenase E1 and transketolase domain containing 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-2082s21c1
Sequence:CCGGGGAGGCACAGTTTGGCGATTTCTCGAGAAATCGCCAAACTGTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-453s21c1
Sequence:CCGGGTTAGTCTATCTCAATCAAATCTCGAGATTTGATTGAGATAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-649s21c1
Sequence:CCGGTTCTCGACAGTGAAGCGATATCTCGAGATATCGCTTCACTGTCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-1354s21c1
Sequence:CCGGTTCCGCAAGGATGTGATTATTCTCGAGAATAATCACATCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-766s21c1
Sequence:CCGGCATAGAGGGAGGCTGAATTTACTCGAGTAAATTCAGCCTCCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-396s21c1
Sequence:CCGGCTTCCACACGGCAGGATTATTCTCGAGAATAATCCTGCCGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-2219s21c1
Sequence:CCGGACCACTCATCCTGTCGAATAGCTCGAGCTATTCGACAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-2023s21c1
Sequence:CCGGGCCGTCCTGGGATTCGAATATCTCGAGATATTCGAATCCCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3291s21c1
Sequence:CCGGTGGGATTGATATACGTGATTTCTCGAGAAATCACGTATATCAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3819s21c1
Sequence:CCGGTGACCCTAATTGACCATATATCTCGAGATATATGGTCAATTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-697s1c1
Sequence:CCGGGCGGGATCACTGATGTCATTACTCGAGTAATGACATCAGTGATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2077s1c1
Sequence:CCGGCCCAGATCATCTTTGACACATCTCGAGATGTGTCAAAGATGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-774s1c1
Sequence:CCGGCCAGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2506s1c1
Sequence:CCGGCCCTGGTGAAACAAAGAGAATCTCGAGATTCTCTTTGTTTCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-231s1c1
Sequence:CCGGGCCAGGTTGGTGACAGTATATCTCGAGATATACTGTCACCAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018706
VALIDATED
DHTKD1 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase E1 and transketolase domain containing 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-2082s21c1
Sequence:CCGGGGAGGCACAGTTTGGCGATTTCTCGAGAAATCGCCAAACTGTGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-453s21c1
Sequence:CCGGGTTAGTCTATCTCAATCAAATCTCGAGATTTGATTGAGATAGACTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018706.5-649s21c1
Sequence:CCGGTTCTCGACAGTGAAGCGATATCTCGAGATATCGCTTCACTGTCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-1354s21c1
Sequence:CCGGTTCCGCAAGGATGTGATTATTCTCGAGAATAATCACATCCTTGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-766s21c1
Sequence:CCGGCATAGAGGGAGGCTGAATTTACTCGAGTAAATTCAGCCTCCCTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-396s21c1
Sequence:CCGGCTTCCACACGGCAGGATTATTCTCGAGAATAATCCTGCCGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-2219s21c1
Sequence:CCGGACCACTCATCCTGTCGAATAGCTCGAGCTATTCGACAGGATGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018706.5-2023s21c1
Sequence:CCGGGCCGTCCTGGGATTCGAATATCTCGAGATATTCGAATCCCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3291s21c1
Sequence:CCGGTGGGATTGATATACGTGATTTCTCGAGAAATCACGTATATCAATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018706.5-3819s21c1
Sequence:CCGGTGACCCTAATTGACCATATATCTCGAGATATATGGTCAATTAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-697s1c1
Sequence:CCGGGCGGGATCACTGATGTCATTACTCGAGTAATGACATCAGTGATCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2077s1c1
Sequence:CCGGCCCAGATCATCTTTGACACATCTCGAGATGTGTCAAAGATGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-774s1c1
Sequence:CCGGCCAGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-2506s1c1
Sequence:CCGGCCCTGGTGAAACAAAGAGAATCTCGAGATTCTCTTTGTTTCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018706.4-231s1c1
Sequence:CCGGGCCAGGTTGGTGACAGTATATCTCGAGATATACTGTCACCAACCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081131
DHTKD1 MISSION shRNA Bacterial Glycerol Stock
dehydrogenase E1 and transketolase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-759s21c1
Sequence:CCGGGCGGTATAACCGACATCATTACTCGAGTAATGATGTCGGTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-858s21c1
Sequence:CCGGTGCGAGGCTTAAGCGAGTTTCCTCGAGGAAACTCGCTTAAGCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081131.2-3331s21c1
Sequence:CCGGGTTCCAACAGATACCACTAAACTCGAGTTTAGTGGTATCTGTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-496s21c1
Sequence:CCGGTATCTACTGTGGCCCAATTTCCTCGAGGAAATTGGGCCACAGTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-836s21c1
Sequence:CCGGCCGGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081131
DHTKD1 MISSION shRNA shRNA Plasmid DNA
dehydrogenase E1 and transketolase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-759s21c1
Sequence:CCGGGCGGTATAACCGACATCATTACTCGAGTAATGATGTCGGTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-858s21c1
Sequence:CCGGTGCGAGGCTTAAGCGAGTTTCCTCGAGGAAACTCGCTTAAGCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081131.2-3331s21c1
Sequence:CCGGGTTCCAACAGATACCACTAAACTCGAGTTTAGTGGTATCTGTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-496s21c1
Sequence:CCGGTATCTACTGTGGCCCAATTTCCTCGAGGAAATTGGGCCACAGTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-836s21c1
Sequence:CCGGCCGGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081131
DHTKD1 MISSION shRNA Lentiviral Transduction Particles
dehydrogenase E1 and transketolase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-759s21c1
Sequence:CCGGGCGGTATAACCGACATCATTACTCGAGTAATGATGTCGGTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-858s21c1
Sequence:CCGGTGCGAGGCTTAAGCGAGTTTCCTCGAGGAAACTCGCTTAAGCCTCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081131.2-3331s21c1
Sequence:CCGGGTTCCAACAGATACCACTAAACTCGAGTTTAGTGGTATCTGTTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-496s21c1
Sequence:CCGGTATCTACTGTGGCCCAATTTCCTCGAGGAAATTGGGCCACAGTAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081131.2-836s21c1
Sequence:CCGGCCGGAGCTGATGTTCCGTAAACTCGAGTTTACGGAACATCAGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks