EMAIL THIS PAGE TO A FRIEND

DHX15

DEAH (Asp-Glu-Ala-His) box helicase 15

111 Gene Product Result for
Synonyms: DBP1 DDX15 HRH2 PRP43 PRPF43 PrPp43p
UniProtKB ID: O43143, Q9NQT7
Gene ID:
Human(1665) Summary: The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]
Mouse(13204) DEAH (Asp-Glu-Ala-His) box polypeptide 15
Rat(289693) DEAH (Asp-Glu-Ala-His) box helicase 15
sheep(101103896) DEAH (Asp-Glu-Ala-His) box polypeptide 15
naked mole-rat(101703351) DEAH (Asp-Glu-Ala-His) box helicase 15
domestic guinea pig(100721234) DEAH (Asp-Glu-Ala-His) box helicase 15
Zebrafish(321931) DEAH (Asp-Glu-Ala-His) box polypeptide 15
cow(512327) DEAH (Asp-Glu-Ala-His) box polypeptide 15
domestic cat(101081543) DEAH (Asp-Glu-Ala-His) box polypeptide 15
dog(488856) DEAH (Asp-Glu-Ala-His) box polypeptide 15
chicken(422813) DEAH (Asp-Glu-Ala-His) box polypeptide 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001358 Rosetta Predictions human pricing
XM_001054651 Rosetta Predictions rat pricing
XM_214053 Rosetta Predictions rat pricing
NM_001042620 Rosetta Predictions mouse pricing
NM_007839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175357 predicted 778
2 SASI_Hs01_00175358 predicted 1013
3 SASI_Hs01_00175359 predicted 1716
4 SASI_Hs01_00175360 predicted 813
5 SASI_Hs01_00175361 predicted 1024
6 SASI_Hs01_00175362 predicted 2619
7 SASI_Hs01_00175363 predicted 1501
8 SASI_Hs01_00175365 predicted 1106
9 SASI_Hs02_00331694 predicted 2572
10 SASI_Hs02_00331695 predicted 2390
11 SASI_Hs01_00175356 predicted 2103
12 SASI_Hs01_00175364 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276637 predicted 2119
2 SASI_Rn02_00276638 predicted 2533
3 SASI_Rn02_00276639 predicted 834
4 SASI_Rn02_00276640 predicted 1741
5 SASI_Rn02_00276641 predicted 2521
6 SASI_Rn02_00276642 predicted 810
7 SASI_Rn02_00276643 predicted 2266
8 SASI_Rn02_00276644 predicted 563
9 SASI_Rn02_00276645 predicted 1195
10 SASI_Rn02_00276646 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375119 predicted 2118
2 SASI_Rn02_00375120 predicted 2533
3 SASI_Rn02_00375121 predicted 840
4 SASI_Rn02_00375122 predicted 1742
5 SASI_Rn02_00375123 predicted 2518
6 SASI_Rn02_00375124 predicted 808
7 SASI_Rn02_00375125 predicted 2260
8 SASI_Rn02_00375126 predicted 564
9 SASI_Rn02_00375127 predicted 1197
10 SASI_Rn02_00375128 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290775 predicted 947
2 SASI_Mm02_00290776 predicted 1003
3 SASI_Mm02_00290777 predicted 811
4 SASI_Mm02_00290778 predicted 1660
5 SASI_Mm02_00290779 predicted 1147
6 SASI_Mm02_00290780 predicted 1505
7 SASI_Mm02_00290781 predicted 781
8 SASI_Mm02_00290782 predicted 1185
9 SASI_Mm02_00290783 predicted 1675
10 SASI_Mm02_00290784 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191874 predicted 948
2 SASI_Mm02_00312583 predicted 1001
3 SASI_Mm01_00191876 predicted 814
4 SASI_Mm01_00191878 predicted 1665
5 SASI_Mm02_00312584 predicted 1151
6 SASI_Mm02_00312585 predicted 1512
7 SASI_Mm01_00191879 predicted 782
8 SASI_Mm02_00312586 predicted 1180
9 SASI_Mm01_00191880 predicted 1679
10 SASI_Mm01_00191881 predicted 974
11 SASI_Mm01_00191872 predicted 2341
12 SASI_Mm01_00191873 predicted 1980
13 SASI_Mm01_00191875 predicted 2253
14 SASI_Mm01_00191877 predicted 2301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001358
VALIDATED
DHX15 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001358.x-2632s1c1
Sequence:CCGGGTTGGTTCGATAATGGCCTTTCTCGAGAAAGGCCATTATCGAACCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1906s1c1
Sequence:CCGGACTGTTCTAATGAGGTCCTATCTCGAGATAGGACCTCATTAGAACAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1257s1c1
Sequence:CCGGTGTAAGAGAATAAAGCGTGAACTCGAGTTCACGCTTTATTCTCTTACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-348s1c1
Sequence:CCGGGCTTCAACAAATGCTATGCTTCTCGAGAAGCATAGCATTTGTTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-579s1c1
Sequence:CCGGTGGGAATACAAGGATAGGTTTCTCGAGAAACCTATCCTTGTATTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-1537s21c1
Sequence:CCGGTTGGTGACAGCTATTAGTAAACTCGAGTTTACTAATAGCTGTCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-691s21c1
Sequence:CCGGGTGGAGTACATGCGATCATTACTCGAGTAATGATCGCATGTACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001358
VALIDATED
DHX15 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001358.x-2632s1c1
Sequence:CCGGGTTGGTTCGATAATGGCCTTTCTCGAGAAAGGCCATTATCGAACCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1906s1c1
Sequence:CCGGACTGTTCTAATGAGGTCCTATCTCGAGATAGGACCTCATTAGAACAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1257s1c1
Sequence:CCGGTGTAAGAGAATAAAGCGTGAACTCGAGTTCACGCTTTATTCTCTTACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-348s1c1
Sequence:CCGGGCTTCAACAAATGCTATGCTTCTCGAGAAGCATAGCATTTGTTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-579s1c1
Sequence:CCGGTGGGAATACAAGGATAGGTTTCTCGAGAAACCTATCCTTGTATTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-1537s21c1
Sequence:CCGGTTGGTGACAGCTATTAGTAAACTCGAGTTTACTAATAGCTGTCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-691s21c1
Sequence:CCGGGTGGAGTACATGCGATCATTACTCGAGTAATGATCGCATGTACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001358
VALIDATED
DHX15 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000006    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001358.x-2632s1c1
Sequence:CCGGGTTGGTTCGATAATGGCCTTTCTCGAGAAAGGCCATTATCGAACCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1906s1c1
Sequence:CCGGACTGTTCTAATGAGGTCCTATCTCGAGATAGGACCTCATTAGAACAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-1257s1c1
Sequence:CCGGTGTAAGAGAATAAAGCGTGAACTCGAGTTCACGCTTTATTCTCTTACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-348s1c1
Sequence:CCGGGCTTCAACAAATGCTATGCTTCTCGAGAAGCATAGCATTTGTTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001358.x-579s1c1
Sequence:CCGGTGGGAATACAAGGATAGGTTTCTCGAGAAACCTATCCTTGTATTCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-1537s21c1
Sequence:CCGGTTGGTGACAGCTATTAGTAAACTCGAGTTTACTAATAGCTGTCACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001358.2-691s21c1
Sequence:CCGGGTGGAGTACATGCGATCATTACTCGAGTAATGATCGCATGTACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007839
VALIDATED
DHX15 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 15
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007839.1-2395s1c1
Sequence:CCGGGCCAACTTCATCAAGGATATACTCGAGTATATCCTTGATGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2264s1c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2027s1c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007839.1-452s1c1
Sequence:CCGGGCTCCCTGTATGGGAATACAACTCGAGTTGTATTCCCATACAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-1174s1c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2152s21c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007839.2-263s21c1
Sequence:CCGGGATAGAGAGGACCGATCTAAACTCGAGTTTAGATCGGTCCTCTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-1299s21c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2389s21c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2738s21c1
Sequence:CCGGTGTTGACACTGTAGCTCATACCTCGAGGTATGAGCTACAGTGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007839
VALIDATED
DHX15 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 15
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007839.1-2395s1c1
Sequence:CCGGGCCAACTTCATCAAGGATATACTCGAGTATATCCTTGATGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2264s1c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2027s1c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007839.1-452s1c1
Sequence:CCGGGCTCCCTGTATGGGAATACAACTCGAGTTGTATTCCCATACAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-1174s1c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2152s21c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007839.2-263s21c1
Sequence:CCGGGATAGAGAGGACCGATCTAAACTCGAGTTTAGATCGGTCCTCTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-1299s21c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2389s21c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2738s21c1
Sequence:CCGGTGTTGACACTGTAGCTCATACCTCGAGGTATGAGCTACAGTGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007839
VALIDATED
DHX15 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 15
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007839.1-2395s1c1
Sequence:CCGGGCCAACTTCATCAAGGATATACTCGAGTATATCCTTGATGAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2264s1c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-2027s1c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007839.1-452s1c1
Sequence:CCGGGCTCCCTGTATGGGAATACAACTCGAGTTGTATTCCCATACAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007839.1-1174s1c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2152s21c1
Sequence:CCGGCCAGCAGCTATCAAGAATTATCTCGAGATAATTCTTGATAGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007839.2-263s21c1
Sequence:CCGGGATAGAGAGGACCGATCTAAACTCGAGTTTAGATCGGTCCTCTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-1299s21c1
Sequence:CCGGGCCCTGAAGTTGGTGATATTACTCGAGTAATATCACCAACTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2389s21c1
Sequence:CCGGGCTGACGACAAAGAATTATATCTCGAGATATAATTCTTTGTCGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007839.2-2738s21c1
Sequence:CCGGTGTTGACACTGTAGCTCATACCTCGAGGTATGAGCTACAGTGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)