EMAIL THIS PAGE TO A FRIEND

DHX16

DEAH (Asp-Glu-Ala-His) box polypeptide 16

59 Gene Product Result for
Synonyms: DBP2 DDX16 PRO2014 PRP8 PRPF2 Prp2
UniProtKB ID: O60231, O60322, Q5JP45, Q969X7, Q96QC1
Gene ID:
Human(8449) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(69192) DEAH (Asp-Glu-Ala-His) box polypeptide 16
Rat(294232) DEAH (Asp-Glu-Ala-His) box polypeptide 16
Zebrafish(336645) DEAH (Asp-Glu-Ala-His) box polypeptide 16
dog(481706) DEAH (Asp-Glu-Ala-His) box polypeptide 16
cow(506405) DEAH (Asp-Glu-Ala-His) box polypeptide 16
domestic cat(101093935) DEAH (Asp-Glu-Ala-His) box polypeptide 16
domestic guinea pig(100719266) DEAH (Asp-Glu-Ala-His) box polypeptide 16
naked mole-rat(101705515) DEAH (Asp-Glu-Ala-His) box polypeptide 16
Goat(100860983) DEAH (Asp-Glu-Ala-His) box polypeptide 16
sheep(101104019) DEAH (Asp-Glu-Ala-His) box polypeptide 16
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003587 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023961 MISSION® esiRNA esiRNA targeting mouse Dhx16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003587 Rosetta Predictions human pricing
NM_212496 Rosetta Predictions rat pricing
NM_026987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085803 predicted 344
2 SASI_Hs01_00085804 predicted 2174
3 SASI_Hs01_00085805 predicted 1908
4 SASI_Hs01_00085807 predicted 2449
5 SASI_Hs01_00085808 predicted 1440
6 SASI_Hs01_00085809 predicted 1451
7 SASI_Hs02_00335909 predicted 3096
8 SASI_Hs01_00085810 predicted 1599
9 SASI_Hs01_00085811 predicted 414
10 SASI_Hs01_00085812 predicted 408
11 SASI_Hs01_00085806 predicted 2840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034058 predicted 1650
2 SASI_Rn01_00034059 predicted 1944
3 SASI_Rn01_00034061 predicted 1434
4 SASI_Rn01_00034062 predicted 861
5 SASI_Rn01_00034063 predicted 2532
6 SASI_Rn01_00034064 predicted 2398
7 SASI_Rn01_00034065 predicted 2704
8 SASI_Rn01_00034066 predicted 1553
9 SASI_Rn01_00034067 predicted 1582
10 SASI_Rn02_00270476 predicted 3094
11 SASI_Rn01_00034060 predicted 3109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027874 predicted 3090
2 SASI_Mm01_00027875 predicted 3074
3 SASI_Mm02_00331326 predicted 3087
4 SASI_Mm01_00027877 predicted 1923
5 SASI_Mm01_00027878 predicted 2190
6 SASI_Mm01_00027879 predicted 1399
7 SASI_Mm01_00027880 predicted 3095
8 SASI_Mm01_00027881 predicted 1544
9 SASI_Mm01_00027882 predicted 1419
10 SASI_Mm02_00331327 predicted 3075
11 SASI_Mm01_00027873 predicted 1637
12 SASI_Mm01_00027876 predicted 2659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026987
VALIDATED
DHX16 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-416s21c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-619s21c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-738s21c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-1964s21c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-2438s21c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-2397s1c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-1923s1c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-697s1c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-375s1c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-578s1c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026987
VALIDATED
DHX16 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-416s21c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-619s21c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-738s21c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-1964s21c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-2438s21c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-2397s1c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-1923s1c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-697s1c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-375s1c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-578s1c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026987
VALIDATED
DHX16 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-416s21c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-619s21c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-738s21c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-1964s21c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026987.2-2438s21c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-2397s1c1
Sequence:CCGGGCTGCTAAAGAGCTTAGGGATCTCGAGATCCCTAAGCTCTTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-1923s1c1
Sequence:CCGGCCCTGGAGATATACTGGTGTTCTCGAGAACACCAGTATATCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-697s1c1
Sequence:CCGGCGGTCAGATAAGAAGGCCTATCTCGAGATAGGCCTTCTTATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-375s1c1
Sequence:CCGGCCGTTCTTATAAGTTGTTGGACTCGAGTCCAACAACTTATAAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026987.1-578s1c1
Sequence:CCGGCCTCAGAGGATGAATGGGAAACTCGAGTTTCCCATTCATCCTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003587
VALIDATED
DHX16 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-488s21c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-281s21c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-1028s21c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-2773s21c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-422s1c1
Sequence:CCGGCGATCTTATAGGTTACTGGAACTCGAGTTCCAGTAACCTATAAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-488s1c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-281s1c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-1028s1c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-2773s1c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003587
VALIDATED
DHX16 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-488s21c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-281s21c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-1028s21c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-2773s21c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-422s1c1
Sequence:CCGGCGATCTTATAGGTTACTGGAACTCGAGTTCCAGTAACCTATAAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-488s1c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-281s1c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-1028s1c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-2773s1c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003587
VALIDATED
DHX16 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-488s21c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-281s21c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-1028s21c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003587.3-2773s21c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-422s1c1
Sequence:CCGGCGATCTTATAGGTTACTGGAACTCGAGTTCCAGTAACCTATAAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-488s1c1
Sequence:CCGGAGCCTCCAGAAGAAACGTAAACTCGAGTTTACGTTTCTTCTGGAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-281s1c1
Sequence:CCGGCGAGACACTGATACCTTGGATCTCGAGATCCAAGGTATCAGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003587.x-1028s1c1
Sequence:CCGGCGCTACCACATGCCCAAGGAACTCGAGTTCCTTGGGCATGTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003587.x-2773s1c1
Sequence:CCGGCCTGGTTCTGCTAAATGTTTACTCGAGTAAACATTTAGCAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks