EMAIL THIS PAGE TO A FRIEND

DHX29

DEAH (Asp-Glu-Ala-His) box polypeptide 29

70 Gene Product Result for
Synonyms: DDX29
Gene ID:
Mouse(218629) DEAH (Asp-Glu-Ala-His) box polypeptide 29
Rat(294741) DEAH (Asp-Glu-Ala-His) box polypeptide 29
sheep(101114811) DEAH (Asp-Glu-Ala-His) box polypeptide 29
Domestic Rabbit(100347321) DEAH (Asp-Glu-Ala-His) box polypeptide 29
naked mole-rat(101724190) DEAH (Asp-Glu-Ala-His) box polypeptide 29
domestic guinea pig(100735097) DEAH (Asp-Glu-Ala-His) box polypeptide 29
chicken(427136) DEAH (Asp-Glu-Ala-His) box polypeptide 29
dog(478060) DEAH (Asp-Glu-Ala-His) box polypeptide 29
cow(512470) DEAH (Asp-Glu-Ala-His) box polypeptide 29
domestic cat(101088051) DEAH (Asp-Glu-Ala-His) box polypeptide 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019030 Rosetta Predictions human pricing
XM_215481 Rosetta Predictions rat pricing
NM_172594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044377 predicted 3641
2 SASI_Hs02_00352587 predicted 2135
3 SASI_Hs01_00044379 predicted 2092
4 SASI_Hs02_00352588 predicted 2747
5 SASI_Hs01_00044380 predicted 2121
6 SASI_Hs01_00044382 predicted 2381
7 SASI_Hs01_00044383 predicted 2547
8 SASI_Hs02_00352589 predicted 3745
9 SASI_Hs01_00044384 predicted 4045
10 SASI_Hs02_00352590 predicted 2289
11 SASI_Hs01_00044378 predicted 2822
12 SASI_Hs01_00044381 predicted 2630
13 SASI_Hs01_00044385 predicted 1386
14 SASI_Hs01_00044386 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142937 predicted 2083
2 SASI_Rn01_00142938 predicted 3253
3 SASI_Rn01_00142939 predicted 4094
4 SASI_Rn01_00142940 predicted 2749
5 SASI_Rn01_00142941 predicted 2439
6 SASI_Rn01_00142942 predicted 2976
7 SASI_Rn01_00142943 predicted 3640
8 SASI_Rn01_00142944 predicted 337
9 SASI_Rn01_00142945 predicted 2102
10 SASI_Rn01_00142946 predicted 2799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147582 predicted 1973
2 SASI_Mm01_00147583 predicted 2323
3 SASI_Mm01_00147584 predicted 477
4 SASI_Mm02_00344289 predicted 2420
5 SASI_Mm01_00147585 predicted 2126
6 SASI_Mm01_00147586 predicted 3620
7 SASI_Mm01_00147587 predicted 2824
8 SASI_Mm01_00147589 predicted 1060
9 SASI_Mm01_00147590 predicted 229
10 SASI_Mm01_00147591 predicted 289
11 SASI_Mm01_00147588 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172594
VALIDATED
DHX29 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-2629s1c1
Sequence:CCGGGCTCACATTCAACAGTTGTATCTCGAGATACAACTGTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172594.2-937s1c1
Sequence:CCGGCCAGCCATAAAGATTTCACATCTCGAGATGTGAAATCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-3402s1c1
Sequence:CCGGCCTCACGATCTACAATGCTTACTCGAGTAAGCATTGTAGATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1075s1c1
Sequence:CCGGCCTCACGATGTAAGGAACTTTCTCGAGAAAGTTCCTTACATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1080s1c1
Sequence:CCGGCGATGTAAGGAACTTTGACTACTCGAGTAGTCAAAGTTCCTTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172594
VALIDATED
DHX29 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-2629s1c1
Sequence:CCGGGCTCACATTCAACAGTTGTATCTCGAGATACAACTGTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172594.2-937s1c1
Sequence:CCGGCCAGCCATAAAGATTTCACATCTCGAGATGTGAAATCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-3402s1c1
Sequence:CCGGCCTCACGATCTACAATGCTTACTCGAGTAAGCATTGTAGATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1075s1c1
Sequence:CCGGCCTCACGATGTAAGGAACTTTCTCGAGAAAGTTCCTTACATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1080s1c1
Sequence:CCGGCGATGTAAGGAACTTTGACTACTCGAGTAGTCAAAGTTCCTTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172594
VALIDATED
DHX29 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-2629s1c1
Sequence:CCGGGCTCACATTCAACAGTTGTATCTCGAGATACAACTGTTGAATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172594.2-937s1c1
Sequence:CCGGCCAGCCATAAAGATTTCACATCTCGAGATGTGAAATCTTTATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-3402s1c1
Sequence:CCGGCCTCACGATCTACAATGCTTACTCGAGTAAGCATTGTAGATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1075s1c1
Sequence:CCGGCCTCACGATGTAAGGAACTTTCTCGAGAAAGTTCCTTACATCGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172594.2-1080s1c1
Sequence:CCGGCGATGTAAGGAACTTTGACTACTCGAGTAGTCAAAGTTCCTTACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019030
VALIDATED
DHX29 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_019030.1-678s1c1
Sequence:CCGGCCTCAAATACAAGCCACTATTCTCGAGAATAGTGGCTTGTATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1779s1c1
Sequence:CCGGCCTAAGTATCAGAAACTTCTACTCGAGTAGAAGTTTCTGATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019030.1-4064s1c1
Sequence:CCGGCCCTGTAAAGATAGCTGTCATCTCGAGATGACAGCTATCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1364s1c1
Sequence:CCGGCCTGGTAGTATGCCCTACAATCTCGAGATTGTAGGGCATACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-3135s1c1
Sequence:CCGGCGTGTACCTTTGGAGGAATTACTCGAGTAATTCCTCCAAAGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2249s21c1
Sequence:CCGGAGTCAGACTTCCTACTAATTACTCGAGTAATTAGTAGGAAGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019030.2-4269s21c1
Sequence:CCGGGAAGATACAGTCATGAAATTACTCGAGTAATTTCATGACTGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-4056s21c1
Sequence:CCGGTATTGATGGCTGGATCTATTTCTCGAGAAATAGATCCAGCCATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2014s21c1
Sequence:CCGGAGAATCTCAGCAGTTAGTTTACTCGAGTAAACTAACTGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019030
VALIDATED
DHX29 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_019030.1-678s1c1
Sequence:CCGGCCTCAAATACAAGCCACTATTCTCGAGAATAGTGGCTTGTATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1779s1c1
Sequence:CCGGCCTAAGTATCAGAAACTTCTACTCGAGTAGAAGTTTCTGATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019030.1-4064s1c1
Sequence:CCGGCCCTGTAAAGATAGCTGTCATCTCGAGATGACAGCTATCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1364s1c1
Sequence:CCGGCCTGGTAGTATGCCCTACAATCTCGAGATTGTAGGGCATACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-3135s1c1
Sequence:CCGGCGTGTACCTTTGGAGGAATTACTCGAGTAATTCCTCCAAAGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2249s21c1
Sequence:CCGGAGTCAGACTTCCTACTAATTACTCGAGTAATTAGTAGGAAGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019030.2-4269s21c1
Sequence:CCGGGAAGATACAGTCATGAAATTACTCGAGTAATTTCATGACTGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-4056s21c1
Sequence:CCGGTATTGATGGCTGGATCTATTTCTCGAGAAATAGATCCAGCCATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2014s21c1
Sequence:CCGGAGAATCTCAGCAGTTAGTTTACTCGAGTAAACTAACTGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019030
VALIDATED
DHX29 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 29
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_019030.1-678s1c1
Sequence:CCGGCCTCAAATACAAGCCACTATTCTCGAGAATAGTGGCTTGTATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1779s1c1
Sequence:CCGGCCTAAGTATCAGAAACTTCTACTCGAGTAGAAGTTTCTGATACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019030.1-4064s1c1
Sequence:CCGGCCCTGTAAAGATAGCTGTCATCTCGAGATGACAGCTATCTTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-1364s1c1
Sequence:CCGGCCTGGTAGTATGCCCTACAATCTCGAGATTGTAGGGCATACTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019030.1-3135s1c1
Sequence:CCGGCGTGTACCTTTGGAGGAATTACTCGAGTAATTCCTCCAAAGGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2249s21c1
Sequence:CCGGAGTCAGACTTCCTACTAATTACTCGAGTAATTAGTAGGAAGTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019030.2-4269s21c1
Sequence:CCGGGAAGATACAGTCATGAAATTACTCGAGTAATTTCATGACTGTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-4056s21c1
Sequence:CCGGTATTGATGGCTGGATCTATTTCTCGAGAAATAGATCCAGCCATCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019030.2-2014s21c1
Sequence:CCGGAGAATCTCAGCAGTTAGTTTACTCGAGTAAACTAACTGCTGAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks