EMAIL THIS PAGE TO A FRIEND

DHX30

DEAH (Asp-Glu-Ala-His) box helicase 30

Synonyms: DDX30 RETCOR
UniProtKB ID: Q7L2E3, A8K5F1, O94965, Q7Z753, Q96CH4, Q9NUQ0
Gene ID:
Human(22907) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The family member encoded by this gene is a mitochondrial nucleoid protein that associates with mitochondrial DNA. It has also been identified as a component of a transcriptional repressor complex that functions in retinal development, and it is required to optimize the function of the zinc-finger antiviral protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(72831) DEAH (Asp-Glu-Ala-His) box polypeptide 30
Rat(367172) DEAH (Asp-Glu-Ala-His) box helicase 30
Zebrafish(570735) DEAH (Asp-Glu-Ala-His) box polypeptide 30
chicken(420376) DEAH (Asp-Glu-Ala-His) box polypeptide 30
domestic cat(101086293) DEAH (Asp-Glu-Ala-His) box polypeptide 30
Horse(100054034) DEAH (Asp-Glu-Ala-His) box polypeptide 30
cow(767607) DEAH (Asp-Glu-Ala-His) box polypeptide 30
dog(476639) DEAH (Asp-Glu-Ala-His) box polypeptide 30
domestic guinea pig(100724876) DEAH (Asp-Glu-Ala-His) box polypeptide 30
naked mole-rat(101700443) DEAH (Asp-Glu-Ala-His) box polypeptide 30
sheep(101121300) DEAH (Asp-Glu-Ala-His) box polypeptide 30
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36525 Anti-DHX30 antibody produced in rabbit affinity isolated antibody bovine, human, rat, rabbit, mouse
western blot pricing
SAB2100578 Anti-DHX30 antibody produced in rabbit affinity isolated antibody rabbit, bovine, guinea pig, mouse, rat, canine, human, horse
western blot pricing
HPA034806 Anti-DHX30 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014966 Rosetta Predictions human pricing
NM_138614 Rosetta Predictions human pricing
NM_138615 Rosetta Predictions human pricing
NM_001013249 Rosetta Predictions rat pricing
NM_133347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346667 predicted 1343
2 SASI_Hs02_00346668 predicted 1381
3 SASI_Hs02_00346669 predicted 981
4 SASI_Hs02_00346670 predicted 2128
5 SASI_Hs01_00141293 predicted 897
6 SASI_Hs02_00346671 predicted 3138
7 SASI_Hs02_00346672 predicted 2850
8 SASI_Hs02_00346673 predicted 1284
9 SASI_Hs02_00346674 predicted 589
10 SASI_Hs02_00346675 predicted 2160
11 SASI_Hs01_00141288 predicted 797
12 SASI_Hs01_00141289 predicted 802
13 SASI_Hs01_00141290 predicted 835
14 SASI_Hs01_00141291 predicted 698
15 SASI_Hs01_00141292 predicted 790
16 SASI_Hs01_00141294 predicted 617
17 SASI_Hs01_00141295 predicted 922
18 SASI_Hs01_00141296 predicted 963
19 SASI_Hs01_00141297 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040209 predicted 740
2 SASI_Hs01_00040210 predicted 738
3 SASI_Hs01_00040211 predicted 771
4 SASI_Hs01_00040212 predicted 636
5 SASI_Hs01_00040213 predicted 727
6 SASI_Hs01_00040214 predicted 846
7 SASI_Hs01_00040215 predicted 561
8 SASI_Hs01_00040216 predicted 853
9 SASI_Hs01_00040217 predicted 893
10 SASI_Hs01_00040218 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363740 predicted 1308
2 SASI_Hs02_00363741 predicted 1354
3 SASI_Hs02_00363742 predicted 958
4 SASI_Hs02_00363743 predicted 2104
5 SASI_Hs01_00071028 predicted 873
6 SASI_Hs02_00363744 predicted 3107
7 SASI_Hs02_00363745 predicted 2827
8 SASI_Hs02_00363746 predicted 1255
9 SASI_Hs02_00363747 predicted 566
10 SASI_Hs02_00363748 predicted 2134
11 SASI_Hs01_00071023 predicted 775
12 SASI_Hs01_00071024 predicted 778
13 SASI_Hs01_00071025 predicted 808
14 SASI_Hs01_00071026 predicted 677
15 SASI_Hs01_00071027 predicted 766
16 SASI_Hs01_00071029 predicted 592
17 SASI_Hs01_00071030 predicted 898
18 SASI_Hs01_00071031 predicted 925
19 SASI_Hs01_00071032 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096453 predicted 946
2 SASI_Rn01_00096454 predicted 286
3 SASI_Rn01_00096456 predicted 916
4 SASI_Rn01_00096457 predicted 3300
5 SASI_Rn02_00201075 predicted 2113
6 SASI_Rn01_00096458 predicted 2135
7 SASI_Rn01_00096459 predicted 1862
8 SASI_Rn01_00096460 predicted 2367
9 SASI_Rn02_00201076 predicted 859
10 SASI_Rn01_00096461 predicted 1130
11 SASI_Rn01_00096455 predicted 1492
12 SASI_Rn01_00096462 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039658 predicted 368
2 SASI_Mm01_00039660 predicted 1560
3 SASI_Mm01_00039661 predicted 1024
4 SASI_Mm02_00338524 predicted 504
5 SASI_Mm01_00039662 predicted 3373
6 SASI_Mm01_00039663 predicted 2187
7 SASI_Mm01_00039665 predicted 991
8 SASI_Mm01_00039666 predicted 928
9 SASI_Mm02_00338525 predicted 3403
10 SASI_Mm02_00338526 predicted 551
11 SASI_Mm01_00039659 predicted 3660
12 SASI_Mm01_00039664 predicted 2458
13 SASI_Mm01_00039667 predicted 1945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133347
DHX30 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-630s21c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3467s21c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3413s21c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3726s21c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-437s21c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3413s1c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-630s1c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3467s1c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3726s1c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-437s1c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133347
DHX30 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-630s21c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3467s21c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3413s21c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3726s21c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-437s21c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3413s1c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-630s1c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3467s1c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3726s1c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-437s1c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133347
DHX30 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-630s21c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3467s21c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3413s21c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-3726s21c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133347.1-437s21c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3413s1c1
Sequence:CCGGGCTGCATAAGTCAACCATTAACTCGAGTTAATGGTTGACTTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-630s1c1
Sequence:CCGGCCACGGAATGAGCTGTTTGATCTCGAGATCAAACAGCTCATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3467s1c1
Sequence:CCGGGACATATTTCATGGCCGTCAACTCGAGTTGACGGCCATGAAATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-3726s1c1
Sequence:CCGGCCTCTTAGTGTGCAGCAAGAACTCGAGTTCTTGCTGCACACTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133347.1-437s1c1
Sequence:CCGGCCTTGGCATCTCACATGCAAACTCGAGTTTGCATGTGAGATGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014966
VALIDATED
DHX30 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014966.3-2390s21c1
Sequence:CCGGGGATGAATGCGCACTCGATTTCTCGAGAAATCGAGTGCGCATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3623s21c1
Sequence:CCGGGCTGCACAAGTCGACCATTAACTCGAGTTAATGGTCGACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3668s21c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2586s21c1
Sequence:CCGGATGGATCAGAAGGCCATATTCCTCGAGGAATATGGCCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2245s21c1
Sequence:CCGGAGCGCTTCTCCCGATACTTTGCTCGAGCAAAGTATCGGGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-434s1c1
Sequence:CCGGGCACACAAATGGACCGAAGAACTCGAGTTCTTCGGTCCATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-3416s1c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-597s1c1
Sequence:CCGGGAGTTGTTTGACGCAGCCAAACTCGAGTTTGGCTGCGTCAAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-1174s1c1
Sequence:CCGGCGCTTACACACGCCATGTATACTCGAGTATACATGGCGTGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-3337s1c1
Sequence:CCGGGCGTCACATATAGGACCAAATCTCGAGATTTGGTCCTATATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014966
VALIDATED
DHX30 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014966.3-2390s21c1
Sequence:CCGGGGATGAATGCGCACTCGATTTCTCGAGAAATCGAGTGCGCATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3623s21c1
Sequence:CCGGGCTGCACAAGTCGACCATTAACTCGAGTTAATGGTCGACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3668s21c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2586s21c1
Sequence:CCGGATGGATCAGAAGGCCATATTCCTCGAGGAATATGGCCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2245s21c1
Sequence:CCGGAGCGCTTCTCCCGATACTTTGCTCGAGCAAAGTATCGGGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-434s1c1
Sequence:CCGGGCACACAAATGGACCGAAGAACTCGAGTTCTTCGGTCCATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-3416s1c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-597s1c1
Sequence:CCGGGAGTTGTTTGACGCAGCCAAACTCGAGTTTGGCTGCGTCAAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-1174s1c1
Sequence:CCGGCGCTTACACACGCCATGTATACTCGAGTATACATGGCGTGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-3337s1c1
Sequence:CCGGGCGTCACATATAGGACCAAATCTCGAGATTTGGTCCTATATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014966
VALIDATED
DHX30 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014966.3-2390s21c1
Sequence:CCGGGGATGAATGCGCACTCGATTTCTCGAGAAATCGAGTGCGCATTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3623s21c1
Sequence:CCGGGCTGCACAAGTCGACCATTAACTCGAGTTAATGGTCGACTTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-3668s21c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2586s21c1
Sequence:CCGGATGGATCAGAAGGCCATATTCCTCGAGGAATATGGCCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014966.3-2245s21c1
Sequence:CCGGAGCGCTTCTCCCGATACTTTGCTCGAGCAAAGTATCGGGAGAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-434s1c1
Sequence:CCGGGCACACAAATGGACCGAAGAACTCGAGTTCTTCGGTCCATTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-3416s1c1
Sequence:CCGGCCGATGGCTGACGTATTTCATCTCGAGATGAAATACGTCAGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014966.2-597s1c1
Sequence:CCGGGAGTTGTTTGACGCAGCCAAACTCGAGTTTGGCTGCGTCAAACAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-1174s1c1
Sequence:CCGGCGCTTACACACGCCATGTATACTCGAGTATACATGGCGTGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014966.2-3337s1c1
Sequence:CCGGGCGTCACATATAGGACCAAATCTCGAGATTTGGTCCTATATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks