EMAIL THIS PAGE TO A FRIEND

DHX32

DEAH (Asp-Glu-Ala-His) box polypeptide 32

Synonyms: DDX32 DHLP1
Gene ID:
Human(55760) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(101437) DEAH (Asp-Glu-Ala-His) box polypeptide 32
Rat(361667) DEAH (Asp-Glu-Ala-His) box polypeptide 32
sheep(101115922) DEAH (Asp-Glu-Ala-His) box polypeptide 32
Domestic Rabbit(100342663) DEAH (Asp-Glu-Ala-His) box polypeptide 32
naked mole-rat(101720489) DEAH (Asp-Glu-Ala-His) box polypeptide 32
domestic guinea pig(100735983) DEAH (Asp-Glu-Ala-His) box polypeptide 32
Zebrafish(558937) DEAH (Asp-Glu-Ala-His) box polypeptide 32
chicken(430203) DEAH (Asp-Glu-Ala-His) box polypeptide 32
cow(532978) DEAH (Asp-Glu-Ala-His) box polypeptide 32
domestic cat(101080831) DEAH (Asp-Glu-Ala-His) box polypeptide 32
Horse(100056281) DEAH (Asp-Glu-Ala-His) box polypeptide 32
dog(100685023) DEAH (Asp-Glu-Ala-His) box polypeptide 32
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077001 MISSION® esiRNA esiRNA human DHX32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018180 Rosetta Predictions human pricing
NM_001130039 Rosetta Predictions rat pricing
XM_341948 Rosetta Predictions rat pricing
NM_133941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351437 predicted 2567
2 SASI_Hs01_00160758 predicted 2532
3 SASI_Hs01_00160759 predicted 1116
4 SASI_Hs01_00160760 predicted 635
5 SASI_Hs02_00351438 predicted 1580
6 SASI_Hs01_00160762 predicted 1601
7 SASI_Hs01_00160764 predicted 1222
8 SASI_Hs01_00160765 predicted 1496
9 SASI_Hs01_00160766 predicted 2333
10 SASI_Hs02_00351439 predicted 620
11 SASI_Hs01_00160761 predicted 513
12 SASI_Hs01_00160763 predicted 1486
13 SASI_Hs01_00160767 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255279 predicted 871
2 SASI_Rn02_00255280 predicted 1903
3 SASI_Rn02_00255281 predicted 2341
4 SASI_Rn02_00255282 predicted 945
5 SASI_Rn02_00255283 predicted 2428
6 SASI_Rn02_00255284 predicted 916
7 SASI_Rn02_00255285 predicted 1103
8 SASI_Rn02_00255286 predicted 564
9 SASI_Rn02_00255287 predicted 2728
10 SASI_Rn02_00255288 predicted 2480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139557 predicted 878
2 SASI_Rn01_00139558 predicted 2305
3 SASI_Rn01_00139559 predicted 1898
4 SASI_Rn01_00139560 predicted 2341
5 SASI_Rn01_00139561 predicted 1201
6 SASI_Rn01_00139562 predicted 948
7 SASI_Rn01_00139563 predicted 2430
8 SASI_Rn01_00139564 predicted 926
9 SASI_Rn01_00139565 predicted 1100
10 SASI_Rn01_00139566 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150090 predicted 1505
2 SASI_Mm01_00150091 predicted 2132
3 SASI_Mm01_00150092 predicted 2325
4 SASI_Mm01_00150093 predicted 961
5 SASI_Mm01_00150094 predicted 2508
6 SASI_Mm01_00150095 predicted 1287
7 SASI_Mm01_00150097 predicted 571
8 SASI_Mm01_00150098 predicted 2446
9 SASI_Mm01_00150099 predicted 2055
10 SASI_Mm02_00339044 predicted 2385
11 SASI_Mm01_00150096 predicted 1924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133941
DHX32 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1132s1c1
Sequence:CCGGGCCTGTCATAGAAGTGAGAAACTCGAGTTTCTCACTTCTATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1274s1c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-2338s1c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1133s1c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1275s1c1
Sequence:CCGGCCTGTGAACAAGATATTGAAACTCGAGTTTCAATATCTTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-2336s21c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1131s21c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-572s21c1
Sequence:CCGGACCGTATTCATCGCGATATTACTCGAGTAATATCGCGATGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1272s21c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133941.2-2733s21c1
Sequence:CCGGGACATGAACACTTCAAGTATGCTCGAGCATACTTGAAGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133941
DHX32 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1132s1c1
Sequence:CCGGGCCTGTCATAGAAGTGAGAAACTCGAGTTTCTCACTTCTATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1274s1c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-2338s1c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1133s1c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1275s1c1
Sequence:CCGGCCTGTGAACAAGATATTGAAACTCGAGTTTCAATATCTTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-2336s21c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1131s21c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-572s21c1
Sequence:CCGGACCGTATTCATCGCGATATTACTCGAGTAATATCGCGATGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1272s21c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133941.2-2733s21c1
Sequence:CCGGGACATGAACACTTCAAGTATGCTCGAGCATACTTGAAGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133941
DHX32 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1132s1c1
Sequence:CCGGGCCTGTCATAGAAGTGAGAAACTCGAGTTTCTCACTTCTATGACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1274s1c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-2338s1c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1133s1c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133941.1-1275s1c1
Sequence:CCGGCCTGTGAACAAGATATTGAAACTCGAGTTTCAATATCTTGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-2336s21c1
Sequence:CCGGCGGGTCAGGTAACTACTTGATCTCGAGATCAAGTAGTTACCTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1131s21c1
Sequence:CCGGCCTGTCATAGAAGTGAGAAATCTCGAGATTTCTCACTTCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-572s21c1
Sequence:CCGGACCGTATTCATCGCGATATTACTCGAGTAATATCGCGATGAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133941.2-1272s21c1
Sequence:CCGGGCCTGTGAACAAGATATTGAACTCGAGTTCAATATCTTGTTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133941.2-2733s21c1
Sequence:CCGGGACATGAACACTTCAAGTATGCTCGAGCATACTTGAAGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018180
VALIDATED
DHX32 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2511s1c1
Sequence:CCGGGAGAACAACTACATCAGGATTCTCGAGAATCCTGATGTAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-629s1c1
Sequence:CCGGGCCATATTCATCACGTTATTACTCGAGTAATAACGTGATGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2768s1c1
Sequence:CCGGGATGGCTGAACTGCTGGATATCTCGAGATATCCAGCAGTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-881s21c1
Sequence:CCGGGGCGGATGAAATGGATGTTAACTCGAGTTAACATCCATTTCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-1077s21c1
Sequence:CCGGGTGTTACTTGGACTTCTTAAACTCGAGTTTAAGAAGTCCAAGTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2797s21c1
Sequence:CCGGCATGACGCGAAGACGGATTTCCTCGAGGAAATCCGTCTTCGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2347s21c1
Sequence:CCGGCTCTTCTGTCCGGTTACTTTACTCGAGTAAAGTAACCGGACAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2479s21c1
Sequence:CCGGAGTGGGTCCTCTTCCATAAATCTCGAGATTTATGGAAGAGGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2389s1c1
Sequence:CCGGATGGATCAGGTAACTACTTAACTCGAGTTAAGTAGTTACCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-1367s1c1
Sequence:CCGGCTATCAAGGATCTAACCTAAACTCGAGTTTAGGTTAGATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018180
VALIDATED
DHX32 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2511s1c1
Sequence:CCGGGAGAACAACTACATCAGGATTCTCGAGAATCCTGATGTAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-629s1c1
Sequence:CCGGGCCATATTCATCACGTTATTACTCGAGTAATAACGTGATGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2768s1c1
Sequence:CCGGGATGGCTGAACTGCTGGATATCTCGAGATATCCAGCAGTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-881s21c1
Sequence:CCGGGGCGGATGAAATGGATGTTAACTCGAGTTAACATCCATTTCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-1077s21c1
Sequence:CCGGGTGTTACTTGGACTTCTTAAACTCGAGTTTAAGAAGTCCAAGTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2797s21c1
Sequence:CCGGCATGACGCGAAGACGGATTTCCTCGAGGAAATCCGTCTTCGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2347s21c1
Sequence:CCGGCTCTTCTGTCCGGTTACTTTACTCGAGTAAAGTAACCGGACAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2479s21c1
Sequence:CCGGAGTGGGTCCTCTTCCATAAATCTCGAGATTTATGGAAGAGGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2389s1c1
Sequence:CCGGATGGATCAGGTAACTACTTAACTCGAGTTAAGTAGTTACCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-1367s1c1
Sequence:CCGGCTATCAAGGATCTAACCTAAACTCGAGTTTAGGTTAGATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018180
VALIDATED
DHX32 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 32
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2511s1c1
Sequence:CCGGGAGAACAACTACATCAGGATTCTCGAGAATCCTGATGTAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-629s1c1
Sequence:CCGGGCCATATTCATCACGTTATTACTCGAGTAATAACGTGATGAATATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180620    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2768s1c1
Sequence:CCGGGATGGCTGAACTGCTGGATATCTCGAGATATCCAGCAGTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-881s21c1
Sequence:CCGGGGCGGATGAAATGGATGTTAACTCGAGTTAACATCCATTTCATCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018180.2-1077s21c1
Sequence:CCGGGTGTTACTTGGACTTCTTAAACTCGAGTTTAAGAAGTCCAAGTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2797s21c1
Sequence:CCGGCATGACGCGAAGACGGATTTCCTCGAGGAAATCCGTCTTCGCGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2347s21c1
Sequence:CCGGCTCTTCTGTCCGGTTACTTTACTCGAGTAAAGTAACCGGACAGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018180.2-2479s21c1
Sequence:CCGGAGTGGGTCCTCTTCCATAAATCTCGAGATTTATGGAAGAGGACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018180.2-2389s1c1
Sequence:CCGGATGGATCAGGTAACTACTTAACTCGAGTTAAGTAGTTACCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018180.2-1367s1c1
Sequence:CCGGCTATCAAGGATCTAACCTAAACTCGAGTTTAGGTTAGATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks