EMAIL THIS PAGE TO A FRIEND

DHX33

DEAH (Asp-Glu-Ala-His) box polypeptide 33

46 Gene Product Result for
Synonyms: DDX33
UniProtKB ID: Q9H6R0, B4DHF9, Q4G149, Q5CZ73, Q9H5M9
Gene ID:
Human(56919) Summary: This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(216877) DEAH (Asp-Glu-Ala-His) box polypeptide 33
Rat(287464) DEAH (Asp-Glu-Ala-His) box polypeptide 33
chicken(417499) DEAH (Asp-Glu-Ala-His) box polypeptide 33
dog(607226) DEAH (Asp-Glu-Ala-His) box polypeptide 33
domestic cat(101090659) DEAH (Asp-Glu-Ala-His) box polypeptide 33
cow(528151) DEAH (Asp-Glu-Ala-His) box polypeptide 33
domestic guinea pig(100726178) DEAH (Asp-Glu-Ala-His) box polypeptide 33
naked mole-rat(101698411) DEAH (Asp-Glu-Ala-His) box polypeptide 33
sheep(101105763) DEAH (Asp-Glu-Ala-His) box polypeptide 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA073875 Anti-DHX33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021391 MISSION® esiRNA esiRNA targeting mouse Dhx33 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020162 Rosetta Predictions human pricing
NM_001105802 Rosetta Predictions rat pricing
NM_178367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196731 predicted 1347
2 SASI_Hs02_00353063 predicted 290
3 SASI_Hs01_00196732 predicted 551
4 SASI_Hs01_00196733 predicted 1673
5 SASI_Hs01_00196734 predicted 1304
6 SASI_Hs01_00196736 predicted 545
7 SASI_Hs01_00196738 predicted 1108
8 SASI_Hs01_00196739 predicted 1451
9 SASI_Hs02_00353064 predicted 1372
10 SASI_Hs01_00196740 predicted 1288
11 SASI_Hs01_00196735 predicted 1431
12 SASI_Hs01_00196737 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212676 predicted 1375
2 SASI_Rn02_00212677 predicted 1321
3 SASI_Rn02_00212678 predicted 583
4 SASI_Rn02_00212679 predicted 1449
5 SASI_Rn02_00212680 predicted 2170
6 SASI_Rn02_00212681 predicted 1788
7 SASI_Rn02_00212682 predicted 1782
8 SASI_Rn02_00212683 predicted 1126
9 SASI_Rn02_00212684 predicted 2223
10 SASI_Rn02_00212685 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348758 predicted 1372
2 SASI_Mm02_00348759 predicted 1783
3 SASI_Mm02_00348760 predicted 1793
4 SASI_Mm02_00348761 predicted 272
5 SASI_Mm02_00348762 predicted 1699
6 SASI_Mm02_00348763 predicted 1454
7 SASI_Mm02_00348764 predicted 1126
8 SASI_Mm02_00348765 predicted 1283
9 SASI_Mm02_00348766 predicted 1189
10 SASI_Mm02_00348767 predicted 1591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020162
VALIDATED
DHX33 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1039s21c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-585s21c1
Sequence:CCGGGAAGCTCACGAACGGACTATCCTCGAGGATAGTCCGTTCGTGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-2242s21c1
Sequence:CCGGTGACTTCCAGGAGCGTGAAAGCTCGAGCTTTCACGCTCCTGGAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1252s21c1
Sequence:CCGGTCTACACGGAGGACGAGTTTGCTCGAGCAAACTCGTCCTCCGTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1110s21c1
Sequence:CCGGGTTGACACGGGCATGGTTAAACTCGAGTTTAACCATGCCCGTGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1688s1c1
Sequence:CCGGGCTCAATATCTATCGGACCTTCTCGAGAAGGTCCGATAGATATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-660s1c1
Sequence:CCGGCTCGGGAAACTTCCTCTGAAACTCGAGTTTCAGAGGAAGTTTCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-537s1c1
Sequence:CCGGGCAATTTCAGACTCTTTGCTTCTCGAGAAGCAAAGAGTCTGAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1498s1c1
Sequence:CCGGCATTTCCTTTAGAACCCAAATCTCGAGATTTGGGTTCTAAAGGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1039s1c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020162
VALIDATED
DHX33 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1039s21c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-585s21c1
Sequence:CCGGGAAGCTCACGAACGGACTATCCTCGAGGATAGTCCGTTCGTGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-2242s21c1
Sequence:CCGGTGACTTCCAGGAGCGTGAAAGCTCGAGCTTTCACGCTCCTGGAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1252s21c1
Sequence:CCGGTCTACACGGAGGACGAGTTTGCTCGAGCAAACTCGTCCTCCGTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1110s21c1
Sequence:CCGGGTTGACACGGGCATGGTTAAACTCGAGTTTAACCATGCCCGTGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1688s1c1
Sequence:CCGGGCTCAATATCTATCGGACCTTCTCGAGAAGGTCCGATAGATATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-660s1c1
Sequence:CCGGCTCGGGAAACTTCCTCTGAAACTCGAGTTTCAGAGGAAGTTTCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-537s1c1
Sequence:CCGGGCAATTTCAGACTCTTTGCTTCTCGAGAAGCAAAGAGTCTGAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1498s1c1
Sequence:CCGGCATTTCCTTTAGAACCCAAATCTCGAGATTTGGGTTCTAAAGGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1039s1c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020162
VALIDATED
DHX33 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1039s21c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-585s21c1
Sequence:CCGGGAAGCTCACGAACGGACTATCCTCGAGGATAGTCCGTTCGTGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303662    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-2242s21c1
Sequence:CCGGTGACTTCCAGGAGCGTGAAAGCTCGAGCTTTCACGCTCCTGGAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1252s21c1
Sequence:CCGGTCTACACGGAGGACGAGTTTGCTCGAGCAAACTCGTCCTCCGTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_020162.2-1110s21c1
Sequence:CCGGGTTGACACGGGCATGGTTAAACTCGAGTTTAACCATGCCCGTGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1688s1c1
Sequence:CCGGGCTCAATATCTATCGGACCTTCTCGAGAAGGTCCGATAGATATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-660s1c1
Sequence:CCGGCTCGGGAAACTTCCTCTGAAACTCGAGTTTCAGAGGAAGTTTCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020162.2-537s1c1
Sequence:CCGGGCAATTTCAGACTCTTTGCTTCTCGAGAAGCAAAGAGTCTGAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1498s1c1
Sequence:CCGGCATTTCCTTTAGAACCCAAATCTCGAGATTTGGGTTCTAAAGGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_020162.2-1039s1c1
Sequence:CCGGGCTATCGCAAAGTGATCATTTCTCGAGAAATGATCACTTTGCGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178367
VALIDATED
DHX33 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178367.3-3959s1c1
Sequence:CCGGCGTGACTACTTGGATAGAAATCTCGAGATTTCTATCCAAGTAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178367.3-696s1c1
Sequence:CCGGGCCTCTCAAAGTGATTGTGATCTCGAGATCACAATCACTTTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1908s1c1
Sequence:CCGGCCTCTTTATGAATACTGCTGACTCGAGTCAGCAGTATTCATAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1366s1c1
Sequence:CCGGCTAGCAATGAAAGTCCCAAATCTCGAGATTTGGGACTTTCATTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1365s1c1
Sequence:CCGGCCTAGCAATGAAAGTCCCAAACTCGAGTTTGGGACTTTCATTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178367
VALIDATED
DHX33 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178367.3-3959s1c1
Sequence:CCGGCGTGACTACTTGGATAGAAATCTCGAGATTTCTATCCAAGTAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178367.3-696s1c1
Sequence:CCGGGCCTCTCAAAGTGATTGTGATCTCGAGATCACAATCACTTTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1908s1c1
Sequence:CCGGCCTCTTTATGAATACTGCTGACTCGAGTCAGCAGTATTCATAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1366s1c1
Sequence:CCGGCTAGCAATGAAAGTCCCAAATCTCGAGATTTGGGACTTTCATTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1365s1c1
Sequence:CCGGCCTAGCAATGAAAGTCCCAAACTCGAGTTTGGGACTTTCATTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178367
VALIDATED
DHX33 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113055    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178367.3-3959s1c1
Sequence:CCGGCGTGACTACTTGGATAGAAATCTCGAGATTTCTATCCAAGTAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178367.3-696s1c1
Sequence:CCGGGCCTCTCAAAGTGATTGTGATCTCGAGATCACAATCACTTTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1908s1c1
Sequence:CCGGCCTCTTTATGAATACTGCTGACTCGAGTCAGCAGTATTCATAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1366s1c1
Sequence:CCGGCTAGCAATGAAAGTCCCAAATCTCGAGATTTGGGACTTTCATTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178367.3-1365s1c1
Sequence:CCGGCCTAGCAATGAAAGTCCCAAACTCGAGTTTGGGACTTTCATTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)