EMAIL THIS PAGE TO A FRIEND

DHX34

DEAH (Asp-Glu-Ala-His) box polypeptide 34

68 Gene Product Result for
Synonyms: DDX34 HRH1
UniProtKB ID: Q14147, B4DMY8
Gene ID:
Human(9704) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Mouse(71723) DEAH (Asp-Glu-Ala-His) box polypeptide 34
Rat(684903) DEAH (Asp-Glu-Ala-His) box polypeptide 34
sheep(101101915) DEAH (Asp-Glu-Ala-His) box polypeptide 34
Domestic Rabbit(100353485) DEAH (Asp-Glu-Ala-His) box polypeptide 34
naked mole-rat(101711892) DEAH (Asp-Glu-Ala-His) box polypeptide 34
domestic guinea pig(100718921) DEAH (Asp-Glu-Ala-His) box polypeptide 34
Zebrafish(555838) DEAH (Asp-Glu-Ala-His) box polypeptide 34
domestic cat(101098347) DEAH (Asp-Glu-Ala-His) box polypeptide 34
Horse(100066021) DEAH (Asp-Glu-Ala-His) box polypeptide 34
cow(506965) DEAH (Asp-Glu-Ala-His) box polypeptide 34
dog(484422) DEAH (Asp-Glu-Ala-His) box polypeptide 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014681 Rosetta Predictions human pricing
NM_194428 Rosetta Predictions human pricing
NM_027883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346041 predicted 3128
2 SASI_Hs02_00346042 predicted 2787
3 SASI_Hs01_00180727 predicted 653
4 SASI_Hs01_00180729 predicted 3302
5 SASI_Hs01_00180730 predicted 1678
6 SASI_Hs01_00180731 predicted 539
7 SASI_Hs01_00180732 predicted 1269
8 SASI_Hs01_00180733 predicted 1163
9 SASI_Hs01_00180734 predicted 630
10 SASI_Hs02_00346043 predicted 3066
11 SASI_Hs01_00180728 predicted 642
12 SASI_Hs01_00180735 predicted 1849
13 SASI_Hs01_00180736 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144007 predicted 780
2 SASI_Hs01_00144008 predicted 657
3 SASI_Hs01_00144009 predicted 642
4 SASI_Hs01_00144010 predicted 1688
5 SASI_Hs01_00144011 predicted 540
6 SASI_Hs01_00144012 predicted 1280
7 SASI_Hs01_00144013 predicted 1172
8 SASI_Hs01_00144014 predicted 629
9 SASI_Hs01_00144015 predicted 1853
10 SASI_Hs01_00144016 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139157 predicted 367
2 SASI_Mm01_00139158 predicted 601
3 SASI_Mm02_00332845 predicted 1950
4 SASI_Mm01_00139159 predicted 927
5 SASI_Mm01_00139160 predicted 3011
6 SASI_Mm01_00139161 predicted 425
7 SASI_Mm01_00139162 predicted 1789
8 SASI_Mm01_00139163 predicted 3426
9 SASI_Mm01_00139164 predicted 2944
10 SASI_Mm01_00139165 predicted 691
11 SASI_Mm01_00139166 predicted 3226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027883
VALIDATED
DHX34 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-3642s1c1
Sequence:CCGGCCGGCCTCTTTGGAAATTCTACTCGAGTAGAATTTCCAAAGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-2083s1c1
Sequence:CCGGCGAGTCTGACTATGATGCCTTCTCGAGAAGGCATCATAGTCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-971s1c1
Sequence:CCGGCGTGCATTGCTTCACTACCTACTCGAGTAGGTAGTGAAGCAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-3235s1c1
Sequence:CCGGCCTGGTGAACTGCGTCAGAATCTCGAGATTCTGACGCAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-701s1c1
Sequence:CCGGCGCGATGAGGATTATATCCGTCTCGAGACGGATATAATCCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027883
VALIDATED
DHX34 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-3642s1c1
Sequence:CCGGCCGGCCTCTTTGGAAATTCTACTCGAGTAGAATTTCCAAAGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-2083s1c1
Sequence:CCGGCGAGTCTGACTATGATGCCTTCTCGAGAAGGCATCATAGTCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-971s1c1
Sequence:CCGGCGTGCATTGCTTCACTACCTACTCGAGTAGGTAGTGAAGCAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-3235s1c1
Sequence:CCGGCCTGGTGAACTGCGTCAGAATCTCGAGATTCTGACGCAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-701s1c1
Sequence:CCGGCGCGATGAGGATTATATCCGTCTCGAGACGGATATAATCCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027883
VALIDATED
DHX34 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-3642s1c1
Sequence:CCGGCCGGCCTCTTTGGAAATTCTACTCGAGTAGAATTTCCAAAGAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-2083s1c1
Sequence:CCGGCGAGTCTGACTATGATGCCTTCTCGAGAAGGCATCATAGTCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-971s1c1
Sequence:CCGGCGTGCATTGCTTCACTACCTACTCGAGTAGGTAGTGAAGCAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027883.2-3235s1c1
Sequence:CCGGCCTGGTGAACTGCGTCAGAATCTCGAGATTCTGACGCAGTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027883.2-701s1c1
Sequence:CCGGCGCGATGAGGATTATATCCGTCTCGAGACGGATATAATCCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014681
VALIDATED
DHX34 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-542s1c1
Sequence:CCGGGCAGAGATTCCAGAATCTCAACTCGAGTTGAGATTCTGGAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014681.3-1699s1c1
Sequence:CCGGGCTTCGTAGTAGATTCCGGAACTCGAGTTCCGGAATCTACTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-2805s1c1
Sequence:CCGGCGAAAGGACTCAGACCAGATTCTCGAGAATCTGGTCTGAGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-3311s1c1
Sequence:CCGGCACGGCATCCAAGATTCCTTACTCGAGTAAGGAATCTTGGATGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-750s1c1
Sequence:CCGGCTGTTGCACTACCTGGACTTTCTCGAGAAAGTCCAGGTAGTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014681.4-1190s21c1
Sequence:CCGGGCGGCATCTCCACAACGATTTCTCGAGAAATCGTTGTGGAGATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1290s21c1
Sequence:CCGGTCGCTCTTCTCCAGCTATTTCCTCGAGGAAATAGCTGGAGAAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1694s21c1
Sequence:CCGGGATCCGCTTCGTAGTAGATTCCTCGAGGAATCTACTACGAAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1599s21c1
Sequence:CCGGGCCGACCAGGACAAGGTATTTCTCGAGAAATACCTTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-3903s21c1
Sequence:CCGGGGAGCACGGATTGTGAATAAACTCGAGTTTATTCACAATCCGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014681
VALIDATED
DHX34 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-542s1c1
Sequence:CCGGGCAGAGATTCCAGAATCTCAACTCGAGTTGAGATTCTGGAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014681.3-1699s1c1
Sequence:CCGGGCTTCGTAGTAGATTCCGGAACTCGAGTTCCGGAATCTACTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-2805s1c1
Sequence:CCGGCGAAAGGACTCAGACCAGATTCTCGAGAATCTGGTCTGAGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-3311s1c1
Sequence:CCGGCACGGCATCCAAGATTCCTTACTCGAGTAAGGAATCTTGGATGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-750s1c1
Sequence:CCGGCTGTTGCACTACCTGGACTTTCTCGAGAAAGTCCAGGTAGTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014681.4-1190s21c1
Sequence:CCGGGCGGCATCTCCACAACGATTTCTCGAGAAATCGTTGTGGAGATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1290s21c1
Sequence:CCGGTCGCTCTTCTCCAGCTATTTCCTCGAGGAAATAGCTGGAGAAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1694s21c1
Sequence:CCGGGATCCGCTTCGTAGTAGATTCCTCGAGGAATCTACTACGAAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1599s21c1
Sequence:CCGGGCCGACCAGGACAAGGTATTTCTCGAGAAATACCTTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-3903s21c1
Sequence:CCGGGGAGCACGGATTGTGAATAAACTCGAGTTTATTCACAATCCGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014681
VALIDATED
DHX34 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-542s1c1
Sequence:CCGGGCAGAGATTCCAGAATCTCAACTCGAGTTGAGATTCTGGAATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014681.3-1699s1c1
Sequence:CCGGGCTTCGTAGTAGATTCCGGAACTCGAGTTCCGGAATCTACTACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-2805s1c1
Sequence:CCGGCGAAAGGACTCAGACCAGATTCTCGAGAATCTGGTCTGAGTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-3311s1c1
Sequence:CCGGCACGGCATCCAAGATTCCTTACTCGAGTAAGGAATCTTGGATGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014681.3-750s1c1
Sequence:CCGGCTGTTGCACTACCTGGACTTTCTCGAGAAAGTCCAGGTAGTGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014681.4-1190s21c1
Sequence:CCGGGCGGCATCTCCACAACGATTTCTCGAGAAATCGTTGTGGAGATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1290s21c1
Sequence:CCGGTCGCTCTTCTCCAGCTATTTCCTCGAGGAAATAGCTGGAGAAGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1694s21c1
Sequence:CCGGGATCCGCTTCGTAGTAGATTCCTCGAGGAATCTACTACGAAGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-1599s21c1
Sequence:CCGGGCCGACCAGGACAAGGTATTTCTCGAGAAATACCTTGTCCTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014681.4-3903s21c1
Sequence:CCGGGGAGCACGGATTGTGAATAAACTCGAGTTTATTCACAATCCGTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks