EMAIL THIS PAGE TO A FRIEND

DHX35

DEAH (Asp-Glu-Ala-His) box polypeptide 35

101 Gene Product Result for
Synonyms: C20orf15 DDX35 KAIA0875
Gene ID:
Human(60625) Summary: DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(71715) DEAH (Asp-Glu-Ala-His) box polypeptide 35
Rat(362260) DEAH (Asp-Glu-Ala-His) box polypeptide 35
chicken(419172) DEAH (Asp-Glu-Ala-His) box polypeptide 35
cow(513148) DEAH (Asp-Glu-Ala-His) box polypeptide 35
domestic cat(101096465) DEAH (Asp-Glu-Ala-His) box polypeptide 35
Horse(100055664) DEAH (Asp-Glu-Ala-His) box polypeptide 35
dog(485872) DEAH (Asp-Glu-Ala-His) box polypeptide 35
domestic guinea pig(100716156) DEAH (Asp-Glu-Ala-His) box polypeptide 35
naked mole-rat(101697468) DEAH (Asp-Glu-Ala-His) box polypeptide 35
sheep(101106193) DEAH (Asp-Glu-Ala-His) box polypeptide 35
Domestic Rabbit(100339380) DEAH (Asp-Glu-Ala-His) box polypeptide 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021931 Rosetta Predictions human pricing
NM_001108601 Rosetta Predictions rat pricing
NM_145742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355222 predicted 1863
2 SASI_Hs01_00093188 predicted 559
3 SASI_Hs01_00093189 predicted 1413
4 SASI_Hs01_00093191 predicted 1743
5 SASI_Hs01_00093192 predicted 700
6 SASI_Hs01_00093193 predicted 232
7 SASI_Hs01_00093194 predicted 1995
8 SASI_Hs01_00093195 predicted 2007
9 SASI_Hs01_00093197 predicted 1373
10 SASI_Hs02_00355223 predicted 642
11 SASI_Hs01_00093190 predicted 494
12 SASI_Hs01_00093196 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240249 predicted 507
2 SASI_Rn02_00240250 predicted 1132
3 SASI_Rn02_00240251 predicted 1726
4 SASI_Rn02_00240252 predicted 1109
5 SASI_Rn02_00240253 predicted 716
6 SASI_Rn02_00240254 predicted 1975
7 SASI_Rn02_00240255 predicted 815
8 SASI_Rn02_00240256 predicted 1586
9 SASI_Rn02_00240257 predicted 1995
10 SASI_Rn02_00240258 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133045 predicted 1130
2 SASI_Mm01_00133046 predicted 1974
3 SASI_Mm01_00133048 predicted 1320
4 SASI_Mm01_00133049 predicted 1469
5 SASI_Mm01_00133050 predicted 1725
6 SASI_Mm01_00133051 predicted 1112
7 SASI_Mm01_00133052 predicted 709
8 SASI_Mm01_00133053 predicted 502
9 SASI_Mm01_00133054 predicted 1099
10 SASI_Mm02_00341272 predicted 813
11 SASI_Mm01_00133047 predicted 1723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145742
VALIDATED
DHX35 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-551s21c1
Sequence:CCGGTGATGGTGGATCCGCTGTTAACTCGAGTTAACAGCGGATCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-823s21c1
Sequence:CCGGAGTCCTGTTCCAGATTATATCCTCGAGGATATAATCTGGAACAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-1716s21c1
Sequence:CCGGCAATGTGTATGAAGCGTTTATCTCGAGATAAACGCTTCATACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-420s21c1
Sequence:CCGGAGGCCGAGTAGCTGATGAAAGCTCGAGCTTTCATCAGCTACTCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145742.1-2528s21c1
Sequence:CCGGGCTATGTGCGTTAAGTATAAACTCGAGTTTATACTTAACGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-284s1c1
Sequence:CCGGCCGTGGTGATTGTTGGAGAAACTCGAGTTTCTCCAACAATCACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-1265s1c1
Sequence:CCGGCGGGAAAGTGTTATCGCCTTTCTCGAGAAAGGCGATAACACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145742.1-1951s1c1
Sequence:CCGGCGGGTTATCTACAATGAAGTACTCGAGTACTTCATTGTAGATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-3052s1c1
Sequence:CCGGCCGTAGCTTGAAAGTTTATTTCTCGAGAAATAAACTTTCAAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145742
VALIDATED
DHX35 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-551s21c1
Sequence:CCGGTGATGGTGGATCCGCTGTTAACTCGAGTTAACAGCGGATCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-823s21c1
Sequence:CCGGAGTCCTGTTCCAGATTATATCCTCGAGGATATAATCTGGAACAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-1716s21c1
Sequence:CCGGCAATGTGTATGAAGCGTTTATCTCGAGATAAACGCTTCATACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-420s21c1
Sequence:CCGGAGGCCGAGTAGCTGATGAAAGCTCGAGCTTTCATCAGCTACTCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145742.1-2528s21c1
Sequence:CCGGGCTATGTGCGTTAAGTATAAACTCGAGTTTATACTTAACGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-284s1c1
Sequence:CCGGCCGTGGTGATTGTTGGAGAAACTCGAGTTTCTCCAACAATCACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-1265s1c1
Sequence:CCGGCGGGAAAGTGTTATCGCCTTTCTCGAGAAAGGCGATAACACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145742.1-1951s1c1
Sequence:CCGGCGGGTTATCTACAATGAAGTACTCGAGTACTTCATTGTAGATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-3052s1c1
Sequence:CCGGCCGTAGCTTGAAAGTTTATTTCTCGAGAAATAAACTTTCAAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145742
VALIDATED
DHX35 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-551s21c1
Sequence:CCGGTGATGGTGGATCCGCTGTTAACTCGAGTTAACAGCGGATCCACCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-823s21c1
Sequence:CCGGAGTCCTGTTCCAGATTATATCCTCGAGGATATAATCTGGAACAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-1716s21c1
Sequence:CCGGCAATGTGTATGAAGCGTTTATCTCGAGATAAACGCTTCATACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145742.1-420s21c1
Sequence:CCGGAGGCCGAGTAGCTGATGAAAGCTCGAGCTTTCATCAGCTACTCGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145742.1-2528s21c1
Sequence:CCGGGCTATGTGCGTTAAGTATAAACTCGAGTTTATACTTAACGCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-284s1c1
Sequence:CCGGCCGTGGTGATTGTTGGAGAAACTCGAGTTTCTCCAACAATCACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-1265s1c1
Sequence:CCGGCGGGAAAGTGTTATCGCCTTTCTCGAGAAAGGCGATAACACTTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145742.1-1951s1c1
Sequence:CCGGCGGGTTATCTACAATGAAGTACTCGAGTACTTCATTGTAGATAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145742.1-3052s1c1
Sequence:CCGGCCGTAGCTTGAAAGTTTATTTCTCGAGAAATAAACTTTCAAGCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021931
VALIDATED
DHX35 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1605s21c1
Sequence:CCGGATTCGAGTGCACCGTAAATTTCTCGAGAAATTTACGGTGCACTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1682s21c1
Sequence:CCGGACACAATAAGGACTCTAAATGCTCGAGCATTTAGAGTCCTTATTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1642s21c1
Sequence:CCGGACCACCTCACTATGCTCAATACTCGAGTATTGAGCATAGTGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021931.2-2373s21c1
Sequence:CCGGTCACTCAGCACGCTCACTAACCTCGAGGTTAGTGAGCGTGCTGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1099s21c1
Sequence:CCGGTGAAACTCCGAGCCTACAATCCTCGAGGATTGTAGGCTCGGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-179s21c1
Sequence:CCGGATTCAAGCTTAGGAATCATATCTCGAGATATGATTCCTAAGCTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1280s1c1
Sequence:CCGGGCGTAGTAATTTGGCACCTGTCTCGAGACAGGTGCCAAATTACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021931.x-1871s1c1
Sequence:CCGGGTTTCATTCTACTGGAGCTTACTCGAGTAAGCTCCAGTAGAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021931.x-2250s1c1
Sequence:CCGGCGGCCTGTTCATTAGTCCTTTCTCGAGAAAGGACTAATGAACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1962s1c1
Sequence:CCGGCGCTGGGTCATCTATAACGAACTCGAGTTCGTTATAGATGACCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021931
VALIDATED
DHX35 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1605s21c1
Sequence:CCGGATTCGAGTGCACCGTAAATTTCTCGAGAAATTTACGGTGCACTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1682s21c1
Sequence:CCGGACACAATAAGGACTCTAAATGCTCGAGCATTTAGAGTCCTTATTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1642s21c1
Sequence:CCGGACCACCTCACTATGCTCAATACTCGAGTATTGAGCATAGTGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021931.2-2373s21c1
Sequence:CCGGTCACTCAGCACGCTCACTAACCTCGAGGTTAGTGAGCGTGCTGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1099s21c1
Sequence:CCGGTGAAACTCCGAGCCTACAATCCTCGAGGATTGTAGGCTCGGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-179s21c1
Sequence:CCGGATTCAAGCTTAGGAATCATATCTCGAGATATGATTCCTAAGCTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1280s1c1
Sequence:CCGGGCGTAGTAATTTGGCACCTGTCTCGAGACAGGTGCCAAATTACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021931.x-1871s1c1
Sequence:CCGGGTTTCATTCTACTGGAGCTTACTCGAGTAAGCTCCAGTAGAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021931.x-2250s1c1
Sequence:CCGGCGGCCTGTTCATTAGTCCTTTCTCGAGAAAGGACTAATGAACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1962s1c1
Sequence:CCGGCGCTGGGTCATCTATAACGAACTCGAGTTCGTTATAGATGACCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021931
VALIDATED
DHX35 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 35
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1605s21c1
Sequence:CCGGATTCGAGTGCACCGTAAATTTCTCGAGAAATTTACGGTGCACTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1682s21c1
Sequence:CCGGACACAATAAGGACTCTAAATGCTCGAGCATTTAGAGTCCTTATTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1642s21c1
Sequence:CCGGACCACCTCACTATGCTCAATACTCGAGTATTGAGCATAGTGAGGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021931.2-2373s21c1
Sequence:CCGGTCACTCAGCACGCTCACTAACCTCGAGGTTAGTGAGCGTGCTGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-1099s21c1
Sequence:CCGGTGAAACTCCGAGCCTACAATCCTCGAGGATTGTAGGCTCGGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021931.2-179s21c1
Sequence:CCGGATTCAAGCTTAGGAATCATATCTCGAGATATGATTCCTAAGCTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1280s1c1
Sequence:CCGGGCGTAGTAATTTGGCACCTGTCTCGAGACAGGTGCCAAATTACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021931.x-1871s1c1
Sequence:CCGGGTTTCATTCTACTGGAGCTTACTCGAGTAAGCTCCAGTAGAATGAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021931.x-2250s1c1
Sequence:CCGGCGGCCTGTTCATTAGTCCTTTCTCGAGAAAGGACTAATGAACAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021931.x-1962s1c1
Sequence:CCGGCGCTGGGTCATCTATAACGAACTCGAGTTCGTTATAGATGACCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks