EMAIL THIS PAGE TO A FRIEND

DHX37

DEAH (Asp-Glu-Ala-His) box polypeptide 37

65 Gene Product Result for
Synonyms: DDX37
UniProtKB ID: Q8IY37, Q9BUI7, Q9P211
Gene ID:
Human(57647) Summary: This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]
Mouse(208144) DEAH (Asp-Glu-Ala-His) box polypeptide 37
Rat(288647) DEAH (Asp-Glu-Ala-His) box polypeptide 37
Zebrafish(100009635) DEAH (Asp-Glu-Ala-His) box polypeptide 37
chicken(416813) DEAH (Asp-Glu-Ala-His) box polypeptide 37
dog(477442) DEAH (Asp-Glu-Ala-His) box polypeptide 37
cow(529207) DEAH (Asp-Glu-Ala-His) box polypeptide 37
domestic cat(101083459) DEAH (Asp-Glu-Ala-His) box polypeptide 37
domestic guinea pig(100719920) DEAH (Asp-Glu-Ala-His) box polypeptide 37
naked mole-rat(101705250) DEAH (Asp-Glu-Ala-His) box polypeptide 37
sheep(101120780) DEAH (Asp-Glu-Ala-His) box polypeptide 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_203319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_203319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_203319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032831 MISSION® esiRNA esiRNA targeting mouse Dhx37 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032656 Rosetta Predictions human pricing
NM_001105926 Rosetta Predictions rat pricing
NM_203319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163634 predicted 1970
2 SASI_Hs01_00163635 predicted 2143
3 SASI_Hs01_00163636 predicted 1698
4 SASI_Hs01_00163637 predicted 1188
5 SASI_Hs01_00163639 predicted 3120
6 SASI_Hs01_00163640 predicted 1896
7 SASI_Hs01_00163641 predicted 3039
8 SASI_Hs01_00163642 predicted 1266
9 SASI_Hs01_00163643 predicted 1121
10 SASI_Hs02_00360210 predicted 1297
11 SASI_Hs01_00163638 predicted 3066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213902 predicted 394
2 SASI_Rn02_00213903 predicted 1534
3 SASI_Rn02_00213904 predicted 1533
4 SASI_Rn02_00213905 predicted 446
5 SASI_Rn02_00213906 predicted 1478
6 SASI_Rn02_00213907 predicted 879
7 SASI_Rn02_00213908 predicted 1073
8 SASI_Rn02_00213909 predicted 1389
9 SASI_Rn02_00213910 predicted 541
10 SASI_Rn02_00213911 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160338 predicted 1022
2 SASI_Mm01_00160339 predicted 3049
3 SASI_Mm01_00160341 predicted 1782
4 SASI_Mm01_00160342 predicted 475
5 SASI_Mm01_00160343 predicted 2945
6 SASI_Mm01_00160344 predicted 997
7 SASI_Mm01_00160345 predicted 3405
8 SASI_Mm01_00160347 predicted 3542
9 SASI_Mm02_00351760 predicted 1136
10 SASI_Mm02_00351761 predicted 2945
11 SASI_Mm01_00160340 predicted 2255
12 SASI_Mm01_00160346 predicted 1599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032656
VALIDATED
DHX37 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-1898s21c1
Sequence:CCGGAGAAGCAAGCACAGGTCTTTACTCGAGTAAAGACCTGTGCTTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-3049s21c1
Sequence:CCGGGAAATCGTGGAGACCACTAAGCTCGAGCTTAGTGGTCTCCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032656.2-3716s21c1
Sequence:CCGGATGAGAGCTCGATCCCGTATGCTCGAGCATACGGGATCGAGCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-2165s21c1
Sequence:CCGGTTGGTGACTTCGAGCAGTTTCCTCGAGGAAACTGCTCGAAGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032656.2-4297s1c1
Sequence:CCGGCCTCAGTTTGTCTCCCTTGTTCTCGAGAACAAGGGAGACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-856s1c1
Sequence:CCGGCCAATTCTCTCCGAAGAACAACTCGAGTTGTTCTTCGGAGAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032656.2-211s1c1
Sequence:CCGGGACACGTTGAAGGGAGTTGATCTCGAGATCAACTCCCTTCAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-1698s1c1
Sequence:CCGGCCAGATCAACTTGGATCATTACTCGAGTAATGATCCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032656
VALIDATED
DHX37 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-1898s21c1
Sequence:CCGGAGAAGCAAGCACAGGTCTTTACTCGAGTAAAGACCTGTGCTTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-3049s21c1
Sequence:CCGGGAAATCGTGGAGACCACTAAGCTCGAGCTTAGTGGTCTCCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032656.2-3716s21c1
Sequence:CCGGATGAGAGCTCGATCCCGTATGCTCGAGCATACGGGATCGAGCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-2165s21c1
Sequence:CCGGTTGGTGACTTCGAGCAGTTTCCTCGAGGAAACTGCTCGAAGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032656.2-4297s1c1
Sequence:CCGGCCTCAGTTTGTCTCCCTTGTTCTCGAGAACAAGGGAGACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-856s1c1
Sequence:CCGGCCAATTCTCTCCGAAGAACAACTCGAGTTGTTCTTCGGAGAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032656.2-211s1c1
Sequence:CCGGGACACGTTGAAGGGAGTTGATCTCGAGATCAACTCCCTTCAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-1698s1c1
Sequence:CCGGCCAGATCAACTTGGATCATTACTCGAGTAATGATCCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032656
VALIDATED
DHX37 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-1898s21c1
Sequence:CCGGAGAAGCAAGCACAGGTCTTTACTCGAGTAAAGACCTGTGCTTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-3049s21c1
Sequence:CCGGGAAATCGTGGAGACCACTAAGCTCGAGCTTAGTGGTCTCCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032656.2-3716s21c1
Sequence:CCGGATGAGAGCTCGATCCCGTATGCTCGAGCATACGGGATCGAGCTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032656.2-2165s21c1
Sequence:CCGGTTGGTGACTTCGAGCAGTTTCCTCGAGGAAACTGCTCGAAGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032656.2-4297s1c1
Sequence:CCGGCCTCAGTTTGTCTCCCTTGTTCTCGAGAACAAGGGAGACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-856s1c1
Sequence:CCGGCCAATTCTCTCCGAAGAACAACTCGAGTTGTTCTTCGGAGAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032656.2-211s1c1
Sequence:CCGGGACACGTTGAAGGGAGTTGATCTCGAGATCAACTCCCTTCAACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032656.2-1698s1c1
Sequence:CCGGCCAGATCAACTTGGATCATTACTCGAGTAATGATCCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203319
DHX37 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203319.1-3586s1c1
Sequence:CCGGCCCTTCTTTGTGACTGTTATACTCGAGTATAACAGTCACAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1355s1c1
Sequence:CCGGCAGTGGTGAATGCTTCAGGAACTCGAGTTCCTGAAGCATTCACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1088s1c1
Sequence:CCGGGCTGAAATACAAGGTGGTGATCTCGAGATCACCACCTTGTATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-3167s1c1
Sequence:CCGGCCGCTACAAATACTTTGCAAACTCGAGTTTGCAAAGTATTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-2850s1c1
Sequence:CCGGGCCTACAAGACTCCTCTTCTACTCGAGTAGAAGAGGAGTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203319
DHX37 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203319.1-3586s1c1
Sequence:CCGGCCCTTCTTTGTGACTGTTATACTCGAGTATAACAGTCACAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1355s1c1
Sequence:CCGGCAGTGGTGAATGCTTCAGGAACTCGAGTTCCTGAAGCATTCACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1088s1c1
Sequence:CCGGGCTGAAATACAAGGTGGTGATCTCGAGATCACCACCTTGTATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-3167s1c1
Sequence:CCGGCCGCTACAAATACTTTGCAAACTCGAGTTTGCAAAGTATTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-2850s1c1
Sequence:CCGGGCCTACAAGACTCCTCTTCTACTCGAGTAGAAGAGGAGTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203319
DHX37 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 37
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203319.1-3586s1c1
Sequence:CCGGCCCTTCTTTGTGACTGTTATACTCGAGTATAACAGTCACAAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1355s1c1
Sequence:CCGGCAGTGGTGAATGCTTCAGGAACTCGAGTTCCTGAAGCATTCACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-1088s1c1
Sequence:CCGGGCTGAAATACAAGGTGGTGATCTCGAGATCACCACCTTGTATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-3167s1c1
Sequence:CCGGCCGCTACAAATACTTTGCAAACTCGAGTTTGCAAAGTATTTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203319.1-2850s1c1
Sequence:CCGGGCCTACAAGACTCCTCTTCTACTCGAGTAGAAGAGGAGTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks