EMAIL THIS PAGE TO A FRIEND

DHX38

DEAH (Asp-Glu-Ala-His) box polypeptide 38

56 Gene Product Result for
Synonyms: DDX38 PRP16 PRPF16
UniProtKB ID: Q92620, D3DWS7, O75212, Q96HN7
Gene ID:
Human(9785) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Mouse(64340) DEAH (Asp-Glu-Ala-His) box polypeptide 38
Rat(292007) DEAH (Asp-Glu-Ala-His) box polypeptide 38
sheep(101123399) DEAH (Asp-Glu-Ala-His) box polypeptide 38
naked mole-rat(101706098) DEAH (Asp-Glu-Ala-His) box polypeptide 38
domestic guinea pig(100714771) DEAH (Asp-Glu-Ala-His) box polypeptide 38
Zebrafish(393850) DEAH (Asp-Glu-Ala-His) box polypeptide 38
chicken(415875) DEAH (Asp-Glu-Ala-His) box polypeptide 38
cow(520046) DEAH (Asp-Glu-Ala-His) box polypeptide 38
domestic cat(101099854) DEAH (Asp-Glu-Ala-His) box polypeptide 38
dog(479669) DEAH (Asp-Glu-Ala-His) box polypeptide 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014003 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014003 Rosetta Predictions human pricing
NM_001106185 Rosetta Predictions rat pricing
NM_178380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115505 predicted 1780
2 SASI_Hs01_00115506 predicted 2819
3 SASI_Hs01_00115507 predicted 2792
4 SASI_Hs01_00115508 predicted 2799
5 SASI_Hs01_00115509 predicted 1431
6 SASI_Hs01_00115510 predicted 1781
7 SASI_Hs01_00115511 predicted 1766
8 SASI_Hs01_00115512 predicted 1808
9 SASI_Hs01_00115513 predicted 1432
10 SASI_Hs01_00115514 predicted 2796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216468 predicted 2163
2 SASI_Rn02_00216469 predicted 1913
3 SASI_Rn02_00216470 predicted 2381
4 SASI_Rn02_00216471 predicted 3809
5 SASI_Rn02_00216472 predicted 533
6 SASI_Rn02_00216473 predicted 764
7 SASI_Rn02_00216474 predicted 3668
8 SASI_Rn02_00216475 predicted 2175
9 SASI_Rn02_00216476 predicted 3530
10 SASI_Rn02_00216477 predicted 1971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084878 predicted 3605
2 SASI_Mm01_00084879 predicted 3575
3 SASI_Mm01_00084880 predicted 3901
4 SASI_Mm01_00084881 predicted 278
5 SASI_Mm01_00084882 predicted 948
6 SASI_Mm02_00348780 predicted 2182
7 SASI_Mm01_00084884 predicted 2103
8 SASI_Mm01_00084885 predicted 1028
9 SASI_Mm01_00084887 predicted 3468
10 SASI_Mm02_00348781 predicted 1761
11 SASI_Mm01_00084883 predicted 1245
12 SASI_Mm01_00084886 predicted 3910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178380
VALIDATED
DHX38 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178380.1-3912s1c1
Sequence:CCGGGCGTGTTCATCTGTGGGTCATCTCGAGATGACCCACAGATGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1590s1c1
Sequence:CCGGCCGGATAAAGCTATGACAGAACTCGAGTTCTGTCATAGCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1589s1c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1637s1c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-3179s1c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-3179s21c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-1589s21c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-1637s21c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-3835s21c1
Sequence:CCGGAGGATGGTGGCCACGTACTAACTCGAGTTAGTACGTGGCCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-882s21c1
Sequence:CCGGCGGGATCGAGACAGGTCTATACTCGAGTATAGACCTGTCTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178380
VALIDATED
DHX38 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178380.1-3912s1c1
Sequence:CCGGGCGTGTTCATCTGTGGGTCATCTCGAGATGACCCACAGATGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1590s1c1
Sequence:CCGGCCGGATAAAGCTATGACAGAACTCGAGTTCTGTCATAGCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1589s1c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1637s1c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-3179s1c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-3179s21c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-1589s21c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-1637s21c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-3835s21c1
Sequence:CCGGAGGATGGTGGCCACGTACTAACTCGAGTTAGTACGTGGCCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-882s21c1
Sequence:CCGGCGGGATCGAGACAGGTCTATACTCGAGTATAGACCTGTCTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178380
VALIDATED
DHX38 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178380.1-3912s1c1
Sequence:CCGGGCGTGTTCATCTGTGGGTCATCTCGAGATGACCCACAGATGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1590s1c1
Sequence:CCGGCCGGATAAAGCTATGACAGAACTCGAGTTCTGTCATAGCTTTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1589s1c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-1637s1c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178380.1-3179s1c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-3179s21c1
Sequence:CCGGGCAGTGGAAGAACAACAATTACTCGAGTAATTGTTGTTCTTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-1589s21c1
Sequence:CCGGGCCGGATAAAGCTATGACAGACTCGAGTCTGTCATAGCTTTATCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178380.1-1637s21c1
Sequence:CCGGGCAGAAGTTTGCAGATCACATCTCGAGATGTGATCTGCAAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-3835s21c1
Sequence:CCGGAGGATGGTGGCCACGTACTAACTCGAGTTAGTACGTGGCCACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178380.1-882s21c1
Sequence:CCGGCGGGATCGAGACAGGTCTATACTCGAGTATAGACCTGTCTCGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014003
VALIDATED
DHX38 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-3913s1c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1847s1c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1771s1c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-195s1c1
Sequence:CCGGGTCAGGTTGGTGGTCTTATTTCTCGAGAAATAAGACCACCAACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014003.x-3184s1c1
Sequence:CCGGGCAGTGGAAGAACAATAATTACTCGAGTAATTATTGTTCTTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1770s21c1
Sequence:CCGGGGACCAAACTGGGAGATATAACTCGAGTTATATCTCCCAGTTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2757s21c1
Sequence:CCGGGCATCGTTGCCACCAATATTGCTCGAGCAATATTGGTGGCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2066s21c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1990s21c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-4132s21c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014003
VALIDATED
DHX38 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-3913s1c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1847s1c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1771s1c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-195s1c1
Sequence:CCGGGTCAGGTTGGTGGTCTTATTTCTCGAGAAATAAGACCACCAACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014003.x-3184s1c1
Sequence:CCGGGCAGTGGAAGAACAATAATTACTCGAGTAATTATTGTTCTTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1770s21c1
Sequence:CCGGGGACCAAACTGGGAGATATAACTCGAGTTATATCTCCCAGTTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2757s21c1
Sequence:CCGGGCATCGTTGCCACCAATATTGCTCGAGCAATATTGGTGGCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2066s21c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1990s21c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-4132s21c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014003
VALIDATED
DHX38 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 38
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-3913s1c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1847s1c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-1771s1c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014003.x-195s1c1
Sequence:CCGGGTCAGGTTGGTGGTCTTATTTCTCGAGAAATAAGACCACCAACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014003.x-3184s1c1
Sequence:CCGGGCAGTGGAAGAACAATAATTACTCGAGTAATTATTGTTCTTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1770s21c1
Sequence:CCGGGGACCAAACTGGGAGATATAACTCGAGTTATATCTCCCAGTTTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2757s21c1
Sequence:CCGGGCATCGTTGCCACCAATATTGCTCGAGCAATATTGGTGGCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-2066s21c1
Sequence:CCGGGAAGATGGTTACACGGACTATCTCGAGATAGTCCGTGTAACCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-1990s21c1
Sequence:CCGGCAGAGACAACAGCATCGTGATCTCGAGATCACGATGCTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014003.3-4132s21c1
Sequence:CCGGGAGGACTTTCATCTGTGCATACTCGAGTATGCACAGATGAAAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks