EMAIL THIS PAGE TO A FRIEND

DHX40

DEAH (Asp-Glu-Ala-His) box polypeptide 40

143 Gene Product Result for
Synonyms: DDX40 PAD
Gene ID:
Human(79665) Summary: This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Mouse(67487) DEAH (Asp-Glu-Ala-His) box polypeptide 40
Rat(287595) DEAH (Asp-Glu-Ala-His) box polypeptide 40
Zebrafish(570225) DEAH (Asp-Glu-Ala-His) box polypeptide 40
cow(533484) DEAH (Asp-Glu-Ala-His) box polypeptide 40
domestic cat(101093472) DEAH (Asp-Glu-Ala-His) box polypeptide 40
dog(480577) DEAH (Asp-Glu-Ala-His) box polypeptide 40
chicken(772090) DEAH (Asp-Glu-Ala-His) box polypeptide 40
domestic guinea pig(100728424) DEAH (Asp-Glu-Ala-His) box polypeptide 40
naked mole-rat(101719959) DEAH (Asp-Glu-Ala-His) box polypeptide 40
sheep(101104508) DEAH (Asp-Glu-Ala-His) box polypeptide 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024612 Rosetta Predictions human pricing
NM_001005873 Rosetta Predictions rat pricing
NM_026191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180687 predicted 1872
2 SASI_Hs01_00180689 predicted 1571
3 SASI_Hs01_00180692 predicted 1995
4 SASI_Hs02_00356977 predicted 1751
5 SASI_Hs01_00180693 predicted 1977
6 SASI_Hs02_00356978 predicted 1451
7 SASI_Hs01_00180694 predicted 1506
8 SASI_Hs01_00180696 predicted 872
9 SASI_Hs02_00356979 predicted 769
10 SASI_Hs02_00356980 predicted 1536
11 SASI_Hs01_00180688 predicted 1493
12 SASI_Hs01_00180690 predicted 1479
13 SASI_Hs01_00180691 predicted 2225
14 SASI_Hs01_00180695 predicted 2227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108502 predicted 1142
2 SASI_Rn01_00108503 predicted 403
3 SASI_Rn01_00108504 predicted 616
4 SASI_Rn01_00108505 predicted 1515
5 SASI_Rn01_00108506 predicted 1361
6 SASI_Rn01_00108507 predicted 1748
7 SASI_Rn01_00108508 predicted 1107
8 SASI_Rn01_00108509 predicted 842
9 SASI_Rn01_00108510 predicted 1941
10 SASI_Rn01_00108511 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119477 predicted 2294
2 SASI_Mm01_00119478 predicted 1494
3 SASI_Mm02_00329856 predicted 255
4 SASI_Mm01_00119481 predicted 1381
5 SASI_Mm01_00119482 predicted 1160
6 SASI_Mm01_00119483 predicted 1126
7 SASI_Mm01_00119484 predicted 867
8 SASI_Mm01_00119485 predicted 1954
9 SASI_Mm01_00119486 predicted 1941
10 SASI_Mm02_00329857 predicted 1451
11 SASI_Mm01_00119479 predicted 616
12 SASI_Mm01_00119480 predicted 2335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024612
VALIDATED
DHX40 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-1972s21c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2236s21c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2187s21c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-490s21c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024612.3-2187s1c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-1972s1c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-490s1c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-356s1c1
Sequence:CCGGCATTCCTTATTGTTACTGGAACTCGAGTTCCAGTAACAATAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-2236s1c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024612
VALIDATED
DHX40 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-1972s21c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2236s21c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2187s21c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-490s21c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024612.3-2187s1c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-1972s1c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-490s1c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-356s1c1
Sequence:CCGGCATTCCTTATTGTTACTGGAACTCGAGTTCCAGTAACAATAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-2236s1c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024612
VALIDATED
DHX40 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-1972s21c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2236s21c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-2187s21c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024612.3-490s21c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024612.3-2187s1c1
Sequence:CCGGCGCAAGAATTGTATGCCCAATCTCGAGATTGGGCATACAATTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-1972s1c1
Sequence:CCGGGAGACCTTTGAAGGCCCTAAACTCGAGTTTAGGGCCTTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-490s1c1
Sequence:CCGGGCTCAGAGAGTAGCTGAAGAACTCGAGTTCTTCAGCTACTCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-356s1c1
Sequence:CCGGCATTCCTTATTGTTACTGGAACTCGAGTTCCAGTAACAATAAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024612.3-2236s1c1
Sequence:CCGGCCCAAGTTGCATGAATTTAATCTCGAGATTAAATTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026191
VALIDATED
DHX40 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-2468s1c1
Sequence:CCGGCCAGGAAATGTGCTTCTGTTTCTCGAGAAACAGAAGCACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-2180s1c1
Sequence:CCGGCCCAAGTTGCATGAACTTAATCTCGAGATTAAGTTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-977s1c1
Sequence:CCGGGCGGAGTCTGTTGACTATGATCTCGAGATCATAGTCAACAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-524s1c1
Sequence:CCGGGCAATCAAATACATGACTGATCTCGAGATCAGTCATGTATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-978s1c1
Sequence:CCGGCGGAGTCTGTTGACTATGATTCTCGAGAATCATAGTCAACAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026191
VALIDATED
DHX40 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-2468s1c1
Sequence:CCGGCCAGGAAATGTGCTTCTGTTTCTCGAGAAACAGAAGCACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-2180s1c1
Sequence:CCGGCCCAAGTTGCATGAACTTAATCTCGAGATTAAGTTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-977s1c1
Sequence:CCGGGCGGAGTCTGTTGACTATGATCTCGAGATCATAGTCAACAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-524s1c1
Sequence:CCGGGCAATCAAATACATGACTGATCTCGAGATCAGTCATGTATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-978s1c1
Sequence:CCGGCGGAGTCTGTTGACTATGATTCTCGAGAATCATAGTCAACAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026191
VALIDATED
DHX40 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-2468s1c1
Sequence:CCGGCCAGGAAATGTGCTTCTGTTTCTCGAGAAACAGAAGCACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-2180s1c1
Sequence:CCGGCCCAAGTTGCATGAACTTAATCTCGAGATTAAGTTCATGCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-977s1c1
Sequence:CCGGGCGGAGTCTGTTGACTATGATCTCGAGATCATAGTCAACAGACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026191.1-524s1c1
Sequence:CCGGGCAATCAAATACATGACTGATCTCGAGATCAGTCATGTATTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026191.1-978s1c1
Sequence:CCGGCGGAGTCTGTTGACTATGATTCTCGAGAATCATAGTCAACAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks