EMAIL THIS PAGE TO A FRIEND

DHX57

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

80 Gene Product Result for
Synonyms: DDX57
Gene ID:
Mouse(106794) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Rat(366532) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
sheep(101118258) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Domestic Rabbit(100357557) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
naked mole-rat(101709085) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
domestic guinea pig(100714961) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Zebrafish(555250) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
domestic cat(101096056) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
cow(540993) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Horse(100053939) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
dog(483040) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
chicken(426560) DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198963 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198963 Rosetta Predictions human pricing
XM_001062787 Rosetta Predictions rat pricing
XM_345625 Rosetta Predictions rat pricing
NM_198942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101927 predicted 1315
2 SASI_Hs01_00101928 predicted 3430
3 SASI_Hs02_00372470 predicted 667
4 SASI_Hs01_00101929 predicted 931
5 SASI_Hs02_00372471 predicted 1552
6 SASI_Hs01_00101931 predicted 2050
7 SASI_Hs01_00101933 predicted 3857
8 SASI_Hs02_00372472 predicted 1791
9 SASI_Hs01_00101935 predicted 1970
10 SASI_Hs01_00101936 predicted 516
11 SASI_Hs01_00101930 predicted 3738
12 SASI_Hs01_00101932 predicted 1614
13 SASI_Hs01_00101934 predicted 2940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304593 predicted 2260
2 SASI_Rn02_00304594 predicted 3606
3 SASI_Rn02_00304595 predicted 3142
4 SASI_Rn02_00304596 predicted 2373
5 SASI_Rn02_00304597 predicted 4221
6 SASI_Rn02_00304598 predicted 2674
7 SASI_Rn02_00304599 predicted 2912
8 SASI_Rn02_00304600 predicted 1747
9 SASI_Rn02_00304601 predicted 2818
10 SASI_Rn02_00304602 predicted 3169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398563 predicted 2266
2 SASI_Rn02_00398564 predicted 3610
3 SASI_Rn02_00398565 predicted 3135
4 SASI_Rn02_00398566 predicted 2373
5 SASI_Rn02_00398567 predicted 4220
6 SASI_Rn02_00398568 predicted 2670
7 SASI_Rn02_00398569 predicted 2905
8 SASI_Rn02_00398570 predicted 1746
9 SASI_Rn02_00398571 predicted 2814
10 SASI_Rn02_00398572 predicted 3172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023649 predicted 2649
2 SASI_Mm01_00023650 predicted 2438
3 SASI_Mm02_00351243 predicted 2298
4 SASI_Mm01_00023651 predicted 3338
5 SASI_Mm01_00023652 predicted 3313
6 SASI_Mm01_00023653 predicted 3496
7 SASI_Mm01_00023655 predicted 2771
8 SASI_Mm01_00023656 predicted 3021
9 SASI_Mm01_00023657 predicted 1961
10 SASI_Mm01_00023658 predicted 3766
11 SASI_Mm01_00023654 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198942
DHX57 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198942.1-4649s1c1
Sequence:CCGGGCTTGTCTTTCTGTGACTGTACTCGAGTACAGTCACAGAAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-2003s1c1
Sequence:CCGGCCACAGTTTATCCTGGATAATCTCGAGATTATCCAGGATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-1730s1c1
Sequence:CCGGGCATCAATTATCGTGGAGAATCTCGAGATTCTCCACGATAATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-719s1c1
Sequence:CCGGGCTGGACAAGAGCCTATCTTTCTCGAGAAAGATAGGCTCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-3353s1c1
Sequence:CCGGCCTCCACATATTGATTCTCTTCTCGAGAAGAGAATCAATATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.2-4597s21c1
Sequence:CCGGGGACACTCCCAGCACAATTTGCTCGAGCAAATTGTGCTGGGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-3015s21c1
Sequence:CCGGACATTGCTGAGACGTCTATAACTCGAGTTATAGACGTCTCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-2678s21c1
Sequence:CCGGCAGCTCTTGATCCGTTATAAACTCGAGTTTATAACGGATCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2677s21c1
Sequence:CCGGGCAGCTCTTGATCCGTTATAACTCGAGTTATAACGGATCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.1-4736s21c1
Sequence:CCGGTGTATCCTTTCCCTCCTATTTCTCGAGAAATAGGAGGGAAAGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2924s21c1
Sequence:CCGGCACCCGCTGCACTCATCATTACTCGAGTAATGATGAGTGCAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-3686s21c1
Sequence:CCGGAGCGCACGAGCAAGCTATAATCTCGAGATTATAGCTTGCTCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198942
DHX57 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198942.1-4649s1c1
Sequence:CCGGGCTTGTCTTTCTGTGACTGTACTCGAGTACAGTCACAGAAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-2003s1c1
Sequence:CCGGCCACAGTTTATCCTGGATAATCTCGAGATTATCCAGGATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-1730s1c1
Sequence:CCGGGCATCAATTATCGTGGAGAATCTCGAGATTCTCCACGATAATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-719s1c1
Sequence:CCGGGCTGGACAAGAGCCTATCTTTCTCGAGAAAGATAGGCTCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-3353s1c1
Sequence:CCGGCCTCCACATATTGATTCTCTTCTCGAGAAGAGAATCAATATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.2-4597s21c1
Sequence:CCGGGGACACTCCCAGCACAATTTGCTCGAGCAAATTGTGCTGGGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-3015s21c1
Sequence:CCGGACATTGCTGAGACGTCTATAACTCGAGTTATAGACGTCTCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-2678s21c1
Sequence:CCGGCAGCTCTTGATCCGTTATAAACTCGAGTTTATAACGGATCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2677s21c1
Sequence:CCGGGCAGCTCTTGATCCGTTATAACTCGAGTTATAACGGATCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.1-4736s21c1
Sequence:CCGGTGTATCCTTTCCCTCCTATTTCTCGAGAAATAGGAGGGAAAGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2924s21c1
Sequence:CCGGCACCCGCTGCACTCATCATTACTCGAGTAATGATGAGTGCAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-3686s21c1
Sequence:CCGGAGCGCACGAGCAAGCTATAATCTCGAGATTATAGCTTGCTCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198942
DHX57 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198942.1-4649s1c1
Sequence:CCGGGCTTGTCTTTCTGTGACTGTACTCGAGTACAGTCACAGAAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-2003s1c1
Sequence:CCGGCCACAGTTTATCCTGGATAATCTCGAGATTATCCAGGATAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-1730s1c1
Sequence:CCGGGCATCAATTATCGTGGAGAATCTCGAGATTCTCCACGATAATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-719s1c1
Sequence:CCGGGCTGGACAAGAGCCTATCTTTCTCGAGAAAGATAGGCTCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198942.1-3353s1c1
Sequence:CCGGCCTCCACATATTGATTCTCTTCTCGAGAAGAGAATCAATATGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.2-4597s21c1
Sequence:CCGGGGACACTCCCAGCACAATTTGCTCGAGCAAATTGTGCTGGGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-3015s21c1
Sequence:CCGGACATTGCTGAGACGTCTATAACTCGAGTTATAGACGTCTCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.2-2678s21c1
Sequence:CCGGCAGCTCTTGATCCGTTATAAACTCGAGTTTATAACGGATCAAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2677s21c1
Sequence:CCGGGCAGCTCTTGATCCGTTATAACTCGAGTTATAACGGATCAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198942.1-4736s21c1
Sequence:CCGGTGTATCCTTTCCCTCCTATTTCTCGAGAAATAGGAGGGAAAGGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-2924s21c1
Sequence:CCGGCACCCGCTGCACTCATCATTACTCGAGTAATGATGAGTGCAGCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198942.1-3686s21c1
Sequence:CCGGAGCGCACGAGCAAGCTATAATCTCGAGATTATAGCTTGCTCGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144995
VALIDATED
DHX57 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144995.2-1663s1c1
Sequence:CCGGCGGTTTATTCAGATGTTGGAACTCGAGTTCCAACATCTGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-540s1c1
Sequence:CCGGGCATCACTAGAGCATCTCCTTCTCGAGAAGGAGATGCTCTAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144995.2-393s1c1
Sequence:CCGGCCTTTGGAATATGCTGGCTTACTCGAGTAAGCCAGCATATTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1096s1c1
Sequence:CCGGCCTTGACATTTGCGGAAACTTCTCGAGAAGTTTCCGCAAATGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1365s1c1
Sequence:CCGGGCACCTGTTATAGTAGAGAATCTCGAGATTCTCTACTATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144995
VALIDATED
DHX57 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144995.2-1663s1c1
Sequence:CCGGCGGTTTATTCAGATGTTGGAACTCGAGTTCCAACATCTGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-540s1c1
Sequence:CCGGGCATCACTAGAGCATCTCCTTCTCGAGAAGGAGATGCTCTAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144995.2-393s1c1
Sequence:CCGGCCTTTGGAATATGCTGGCTTACTCGAGTAAGCCAGCATATTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1096s1c1
Sequence:CCGGCCTTGACATTTGCGGAAACTTCTCGAGAAGTTTCCGCAAATGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1365s1c1
Sequence:CCGGGCACCTGTTATAGTAGAGAATCTCGAGATTCTCTACTATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144995
VALIDATED
DHX57 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144995.2-1663s1c1
Sequence:CCGGCGGTTTATTCAGATGTTGGAACTCGAGTTCCAACATCTGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-540s1c1
Sequence:CCGGGCATCACTAGAGCATCTCCTTCTCGAGAAGGAGATGCTCTAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144995.2-393s1c1
Sequence:CCGGCCTTTGGAATATGCTGGCTTACTCGAGTAAGCCAGCATATTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1096s1c1
Sequence:CCGGCCTTGACATTTGCGGAAACTTCTCGAGAAGTTTCCGCAAATGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_144995.2-1365s1c1
Sequence:CCGGGCACCTGTTATAGTAGAGAATCTCGAGATTCTCTACTATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198963
VALIDATED
DHX57 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-2254s21c1
Sequence:CCGGACTATACCAGGTCGTACATTTCTCGAGAAATGTACGACCTGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3598s21c1
Sequence:CCGGACGGAACTGTTATCGGATATACTCGAGTATATCCGATAACAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-4323s21c1
Sequence:CCGGGAACCTCTACCTCGAACTAAACTCGAGTTTAGTTCGAGGTAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198963.1-323s21c1
Sequence:CCGGGACCTAGCAACAGTAACATAACTCGAGTTATGTTACTGTTGCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3510s21c1
Sequence:CCGGAGGCGTGCGTGCAAGTTATAACTCGAGTTATAACTTGCACGCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198963
VALIDATED
DHX57 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-2254s21c1
Sequence:CCGGACTATACCAGGTCGTACATTTCTCGAGAAATGTACGACCTGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3598s21c1
Sequence:CCGGACGGAACTGTTATCGGATATACTCGAGTATATCCGATAACAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-4323s21c1
Sequence:CCGGGAACCTCTACCTCGAACTAAACTCGAGTTTAGTTCGAGGTAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198963.1-323s21c1
Sequence:CCGGGACCTAGCAACAGTAACATAACTCGAGTTATGTTACTGTTGCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3510s21c1
Sequence:CCGGAGGCGTGCGTGCAAGTTATAACTCGAGTTATAACTTGCACGCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198963
VALIDATED
DHX57 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-2254s21c1
Sequence:CCGGACTATACCAGGTCGTACATTTCTCGAGAAATGTACGACCTGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3598s21c1
Sequence:CCGGACGGAACTGTTATCGGATATACTCGAGTATATCCGATAACAGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-4323s21c1
Sequence:CCGGGAACCTCTACCTCGAACTAAACTCGAGTTTAGTTCGAGGTAGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198963.1-323s21c1
Sequence:CCGGGACCTAGCAACAGTAACATAACTCGAGTTATGTTACTGTTGCTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_198963.1-3510s21c1
Sequence:CCGGAGGCGTGCGTGCAAGTTATAACTCGAGTTATAACTTGCACGCACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks