EMAIL THIS PAGE TO A FRIEND

DHX58

DEXH (Asp-Glu-X-His) box polypeptide 58

53 Gene Product Result for
Synonyms: D11LGP2 D11lgp2e LGP2 RLR-3
UniProtKB ID: Q96C10, Q9HAM6
Gene ID:
Mouse(80861) DEXH (Asp-Glu-X-His) box polypeptide 58
Rat(303538) DEXH (Asp-Glu-X-His) box polypeptide 58
Zebrafish(100148871) DEXH (Asp-Glu-X-His) box polypeptide 58
chicken(100858653) DEXH (Asp-Glu-X-His) box polypeptide 58
cow(508378) DEXH (Asp-Glu-X-His) box polypeptide 58
Horse(100066316) DEXH (Asp-Glu-X-His) box polypeptide 58
domestic cat(101094463) DEXH (Asp-Glu-X-His) box polypeptide 58
dog(607803) DEXH (Asp-Glu-X-His) box polypeptide 58
domestic guinea pig(100715966) DEXH (Asp-Glu-X-His) box polypeptide 58
naked mole-rat(101697926) DEXH (Asp-Glu-X-His) box polypeptide 58
sheep(101121528) DEXH (Asp-Glu-X-His) box polypeptide 58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024119 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089271 MISSION® esiRNA esiRNA targeting mouse Dhx58 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024119 Rosetta Predictions human pricing
NM_001098788 Rosetta Predictions rat pricing
NM_030150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150552 predicted 1578
2 SASI_Hs01_00150553 predicted 973
3 SASI_Hs01_00150554 predicted 639
4 SASI_Hs01_00150555 predicted 1650
5 SASI_Hs01_00150556 predicted 1567
6 SASI_Hs01_00150557 predicted 1243
7 SASI_Hs01_00150558 predicted 756
8 SASI_Hs01_00150559 predicted 1774
9 SASI_Hs01_00150560 predicted 649
10 SASI_Hs01_00150561 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209171 predicted 1768
2 SASI_Rn02_00209172 predicted 904
3 SASI_Rn02_00209173 predicted 986
4 SASI_Rn02_00209174 predicted 916
5 SASI_Rn02_00209175 predicted 374
6 SASI_Rn02_00209176 predicted 268
7 SASI_Rn02_00209177 predicted 768
8 SASI_Rn02_00209178 predicted 1340
9 SASI_Rn02_00209179 predicted 1332
10 SASI_Rn02_00209180 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176299 predicted 1394
2 SASI_Mm01_00176300 predicted 472
3 SASI_Mm01_00176301 predicted 213
4 SASI_Mm01_00176302 predicted 956
5 SASI_Mm01_00176303 predicted 520
6 SASI_Mm01_00176304 predicted 308
7 SASI_Mm01_00176305 predicted 1886
8 SASI_Mm01_00176306 predicted 962
9 SASI_Mm01_00176307 predicted 1924
10 SASI_Mm01_00176308 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024119
DHX58 MISSION shRNA Bacterial Glycerol Stock
DEXH (Asp-Glu-X-His) box polypeptide 58
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-1154s21c1
Sequence:CCGGCACAGGGAGCACGTCACTAAACTCGAGTTTAGTGACGTGCTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-663s21c1
Sequence:CCGGGCCAGTACCTAGAACTTAAACCTCGAGGTTTAAGTTCTAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1967s1c1
Sequence:CCGGCCCAACTTCTCGAACTACTATCTCGAGATAGTAGTTCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1483s1c1
Sequence:CCGGGCAAGAAGTGATCCAGAAGTTCTCGAGAACTTCTGGATCACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1211s1c1
Sequence:CCGGCTGTTCGATGACCGCAAGAATCTCGAGATTCTTGCGGTCATCGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-973s1c1
Sequence:CCGGCCGGAAATTTGGGACGCAAATCTCGAGATTTGCGTCCCAAATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-341s1c1
Sequence:CCGGCGGCACCTAGAGACTGTGGATCTCGAGATCCACAGTCTCTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024119
DHX58 MISSION shRNA shRNA Plasmid DNA
DEXH (Asp-Glu-X-His) box polypeptide 58
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-1154s21c1
Sequence:CCGGCACAGGGAGCACGTCACTAAACTCGAGTTTAGTGACGTGCTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-663s21c1
Sequence:CCGGGCCAGTACCTAGAACTTAAACCTCGAGGTTTAAGTTCTAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1967s1c1
Sequence:CCGGCCCAACTTCTCGAACTACTATCTCGAGATAGTAGTTCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1483s1c1
Sequence:CCGGGCAAGAAGTGATCCAGAAGTTCTCGAGAACTTCTGGATCACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1211s1c1
Sequence:CCGGCTGTTCGATGACCGCAAGAATCTCGAGATTCTTGCGGTCATCGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-973s1c1
Sequence:CCGGCCGGAAATTTGGGACGCAAATCTCGAGATTTGCGTCCCAAATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-341s1c1
Sequence:CCGGCGGCACCTAGAGACTGTGGATCTCGAGATCCACAGTCTCTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024119
DHX58 MISSION shRNA Lentiviral Transduction Particles
DEXH (Asp-Glu-X-His) box polypeptide 58
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-1154s21c1
Sequence:CCGGCACAGGGAGCACGTCACTAAACTCGAGTTTAGTGACGTGCTCCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024119.2-663s21c1
Sequence:CCGGGCCAGTACCTAGAACTTAAACCTCGAGGTTTAAGTTCTAGGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1967s1c1
Sequence:CCGGCCCAACTTCTCGAACTACTATCTCGAGATAGTAGTTCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1483s1c1
Sequence:CCGGGCAAGAAGTGATCCAGAAGTTCTCGAGAACTTCTGGATCACTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-1211s1c1
Sequence:CCGGCTGTTCGATGACCGCAAGAATCTCGAGATTCTTGCGGTCATCGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-973s1c1
Sequence:CCGGCCGGAAATTTGGGACGCAAATCTCGAGATTTGCGTCCCAAATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024119.1-341s1c1
Sequence:CCGGCGGCACCTAGAGACTGTGGATCTCGAGATCCACAGTCTCTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030150
VALIDATED
DHX58 MISSION shRNA Bacterial Glycerol Stock
DEXH (Asp-Glu-X-His) box polypeptide 58
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-657s21c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030150.2-2266s21c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-2074s21c1
Sequence:CCGGTCCATACCAGTCTTCGATATCCTCGAGGATATCGAAGACTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-959s21c1
Sequence:CCGGGCTACAATGATGCGCTATTTACTCGAGTAAATAGCGCATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-1875s21c1
Sequence:CCGGCCAGAACCCTGTGGTCATTAACTCGAGTTAATGACCACAGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-2266s1c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-958s1c1
Sequence:CCGGCGCTACAATGATGCGCTATTTCTCGAGAAATAGCGCATCATTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-841s1c1
Sequence:CCGGCCTGACTTGAAGCAACAATTTCTCGAGAAATTGTTGCTTCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-657s1c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-1846s1c1
Sequence:CCGGCCCAACTTCTCGGTCTACTATCTCGAGATAGTAGACCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030150
VALIDATED
DHX58 MISSION shRNA shRNA Plasmid DNA
DEXH (Asp-Glu-X-His) box polypeptide 58
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-657s21c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030150.2-2266s21c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-2074s21c1
Sequence:CCGGTCCATACCAGTCTTCGATATCCTCGAGGATATCGAAGACTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-959s21c1
Sequence:CCGGGCTACAATGATGCGCTATTTACTCGAGTAAATAGCGCATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-1875s21c1
Sequence:CCGGCCAGAACCCTGTGGTCATTAACTCGAGTTAATGACCACAGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-2266s1c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-958s1c1
Sequence:CCGGCGCTACAATGATGCGCTATTTCTCGAGAAATAGCGCATCATTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-841s1c1
Sequence:CCGGCCTGACTTGAAGCAACAATTTCTCGAGAAATTGTTGCTTCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-657s1c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-1846s1c1
Sequence:CCGGCCCAACTTCTCGGTCTACTATCTCGAGATAGTAGACCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030150
VALIDATED
DHX58 MISSION shRNA Lentiviral Transduction Particles
DEXH (Asp-Glu-X-His) box polypeptide 58
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-657s21c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030150.2-2266s21c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-2074s21c1
Sequence:CCGGTCCATACCAGTCTTCGATATCCTCGAGGATATCGAAGACTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-959s21c1
Sequence:CCGGGCTACAATGATGCGCTATTTACTCGAGTAAATAGCGCATCATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030150.2-1875s21c1
Sequence:CCGGCCAGAACCCTGTGGTCATTAACTCGAGTTAATGACCACAGGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-2266s1c1
Sequence:CCGGCATTGGATGGAGTTGGAAGATCTCGAGATCTTCCAACTCCATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-958s1c1
Sequence:CCGGCGCTACAATGATGCGCTATTTCTCGAGAAATAGCGCATCATTGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-841s1c1
Sequence:CCGGCCTGACTTGAAGCAACAATTTCTCGAGAAATTGTTGCTTCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-657s1c1
Sequence:CCGGCCTACAGCTTTGTGCGAATTTCTCGAGAAATTCGCACAAAGCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_030150.2-1846s1c1
Sequence:CCGGCCCAACTTCTCGGTCTACTATCTCGAGATAGTAGACCGAGAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks