EMAIL THIS PAGE TO A FRIEND

DHX8

DEAH (Asp-Glu-Ala-His) box polypeptide 8

Synonyms: DDX8 HRH1 PRP22 PRPF22
UniProtKB ID: Q14562
Gene ID:
Human(1659) Summary: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is highly homologous to yeast Prp22. This protein facilitates nuclear export of spliced mRNA by releasing the RNA from the spliceosome. [provided by RefSeq, Jul 2008]
Mouse(217207) DEAH (Asp-Glu-Ala-His) box polypeptide 8
Rat(287727) DEAH (Asp-Glu-Ala-His) box polypeptide 8
sheep(101110072) DEAH (Asp-Glu-Ala-His) box polypeptide 8
naked mole-rat(101704043) DEAH (Asp-Glu-Ala-His) box polypeptide 8
domestic guinea pig(100722807) DEAH (Asp-Glu-Ala-His) box polypeptide 8
Zebrafish(606595) DEAH (Asp-Glu-Ala-His) box polypeptide 8
chicken(419982) DEAH (Asp-Glu-Ala-His) box polypeptide 8
dog(480507) DEAH (Asp-Glu-Ala-His) box polypeptide 8
Horse(100051804) DEAH (Asp-Glu-Ala-His) box polypeptide 8
cow(536093) DEAH (Asp-Glu-Ala-His) box polypeptide 8
domestic cat(101094639) DEAH (Asp-Glu-Ala-His) box polypeptide 8
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004941 Rosetta Predictions human pricing
NM_001047844 Rosetta Predictions rat pricing
NM_144831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228562 predicted 2127
2 SASI_Hs01_00228563 predicted 2359
3 SASI_Hs02_00338613 predicted 1628
4 SASI_Hs01_00228564 predicted 3504
5 SASI_Hs01_00228565 predicted 2192
6 SASI_Hs01_00228566 predicted 1110
7 SASI_Hs01_00228567 predicted 1164
8 SASI_Hs01_00228568 predicted 1700
9 SASI_Hs01_00228570 predicted 2607
10 SASI_Hs02_00338614 predicted 2454
11 SASI_Hs01_00228569 predicted 2831
12 SASI_Hs01_00228571 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206115 predicted 3150
2 SASI_Rn02_00206116 predicted 1801
3 SASI_Rn02_00206117 predicted 1961
4 SASI_Rn02_00206118 predicted 903
5 SASI_Rn02_00206119 predicted 2265
6 SASI_Rn02_00206120 predicted 1642
7 SASI_Rn02_00206121 predicted 844
8 SASI_Rn02_00206122 predicted 982
9 SASI_Rn02_00206123 predicted 1860
10 SASI_Rn02_00206124 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340213 predicted 2735
2 SASI_Mm02_00340214 predicted 222
3 SASI_Mm02_00340215 predicted 1199
4 SASI_Mm02_00340216 predicted 2013
5 SASI_Mm02_00340217 predicted 1892
6 SASI_Mm02_00340218 predicted 1900
7 SASI_Mm02_00340219 predicted 2520
8 SASI_Mm02_00340220 predicted 2838
9 SASI_Mm02_00340221 predicted 2189
10 SASI_Mm02_00340222 predicted 2038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004941
VALIDATED
DHX8 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-4166s1c1
Sequence:CCGGTGGCTTGACCTCGTGGAAATACTCGAGTATTTCCACGAGGTCAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-631s1c1
Sequence:CCGGAGACAGAGATAGGGAACGAAACTCGAGTTTCGTTCCCTATCTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004941.x-1765s1c1
Sequence:CCGGCCTGCCCATCTACAAACTGAACTCGAGTTCAGTTTGTAGATGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-2586s1c1
Sequence:CCGGCCACCAATATCGCAGAGACATCTCGAGATGTCTCTGCGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-3626s1c1
Sequence:CCGGGACCCAACTAAGCTAAGCAAACTCGAGTTTGCTTAGCTTAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2279s21c1
Sequence:CCGGACCATCCCAGGTCGAACATATCTCGAGATATGTTCGACCTGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-1093s21c1
Sequence:CCGGAGAGACTGGAGAAGATCTAAACTCGAGTTTAGATCTTCTCCAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2691s21c1
Sequence:CCGGAGCTCGTGGTGACGCCTATTTCTCGAGAAATAGGCGTCACCACGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-808s21c1
Sequence:CCGGTCTGGATAGATGGCGGGATAACTCGAGTTATCCCGCCATCTATCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004941
VALIDATED
DHX8 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-4166s1c1
Sequence:CCGGTGGCTTGACCTCGTGGAAATACTCGAGTATTTCCACGAGGTCAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-631s1c1
Sequence:CCGGAGACAGAGATAGGGAACGAAACTCGAGTTTCGTTCCCTATCTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004941.x-1765s1c1
Sequence:CCGGCCTGCCCATCTACAAACTGAACTCGAGTTCAGTTTGTAGATGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-2586s1c1
Sequence:CCGGCCACCAATATCGCAGAGACATCTCGAGATGTCTCTGCGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-3626s1c1
Sequence:CCGGGACCCAACTAAGCTAAGCAAACTCGAGTTTGCTTAGCTTAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2279s21c1
Sequence:CCGGACCATCCCAGGTCGAACATATCTCGAGATATGTTCGACCTGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-1093s21c1
Sequence:CCGGAGAGACTGGAGAAGATCTAAACTCGAGTTTAGATCTTCTCCAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2691s21c1
Sequence:CCGGAGCTCGTGGTGACGCCTATTTCTCGAGAAATAGGCGTCACCACGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-808s21c1
Sequence:CCGGTCTGGATAGATGGCGGGATAACTCGAGTTATCCCGCCATCTATCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004941
VALIDATED
DHX8 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-4166s1c1
Sequence:CCGGTGGCTTGACCTCGTGGAAATACTCGAGTATTTCCACGAGGTCAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-631s1c1
Sequence:CCGGAGACAGAGATAGGGAACGAAACTCGAGTTTCGTTCCCTATCTCTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004941.x-1765s1c1
Sequence:CCGGCCTGCCCATCTACAAACTGAACTCGAGTTCAGTTTGTAGATGGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-2586s1c1
Sequence:CCGGCCACCAATATCGCAGAGACATCTCGAGATGTCTCTGCGATATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004941.x-3626s1c1
Sequence:CCGGGACCCAACTAAGCTAAGCAAACTCGAGTTTGCTTAGCTTAGTTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2279s21c1
Sequence:CCGGACCATCCCAGGTCGAACATATCTCGAGATATGTTCGACCTGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-1093s21c1
Sequence:CCGGAGAGACTGGAGAAGATCTAAACTCGAGTTTAGATCTTCTCCAGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-2691s21c1
Sequence:CCGGAGCTCGTGGTGACGCCTATTTCTCGAGAAATAGGCGTCACCACGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004941.1-808s21c1
Sequence:CCGGTCTGGATAGATGGCGGGATAACTCGAGTTATCCCGCCATCTATCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144831
VALIDATED
DHX8 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-374s1c1
Sequence:CCGGGATGCTAACTATCGTGTCCATCTCGAGATGGACACGATAGTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-156s1c2
Sequence:CCGGCTCAAGGCCATGGGTATTAATCTCGAGATTAATACCCATGGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-905s1c1
Sequence:CCGGCAAAGTTTCTGACCCAACCAACTCGAGTTGGTTGGGTCAGAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-444s1c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-608s1c1
Sequence:CCGGGTTAGGCATAATGGACAGGCACTCGAGTGCCTGTCCATTATGCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-776s1c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-3892s1c1
Sequence:CCGGCTGATCTTAAACTGAGCATTTCTCGAGAAATGCTCAGTTTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-4144s1c1
Sequence:CCGGCAAGGGACATGAGTAACTGATCTCGAGATCAGTTACTCATGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3571s21c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2408s21c1
Sequence:CCGGGAGCCGGAAACAGACTATTTGCTCGAGCAAATAGTCTGTTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144831.2-3960s21c1
Sequence:CCGGGGCTTTGGCCAGAGCCTTTAACTCGAGTTAAAGGCTCTGGCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2775s21c1
Sequence:CCGGAGCTTGTGGTGACACCTATTTCTCGAGAAATAGGTGTCACCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3239s21c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144831
VALIDATED
DHX8 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-374s1c1
Sequence:CCGGGATGCTAACTATCGTGTCCATCTCGAGATGGACACGATAGTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-156s1c2
Sequence:CCGGCTCAAGGCCATGGGTATTAATCTCGAGATTAATACCCATGGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-905s1c1
Sequence:CCGGCAAAGTTTCTGACCCAACCAACTCGAGTTGGTTGGGTCAGAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-444s1c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-608s1c1
Sequence:CCGGGTTAGGCATAATGGACAGGCACTCGAGTGCCTGTCCATTATGCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-776s1c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-3892s1c1
Sequence:CCGGCTGATCTTAAACTGAGCATTTCTCGAGAAATGCTCAGTTTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-4144s1c1
Sequence:CCGGCAAGGGACATGAGTAACTGATCTCGAGATCAGTTACTCATGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3571s21c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2408s21c1
Sequence:CCGGGAGCCGGAAACAGACTATTTGCTCGAGCAAATAGTCTGTTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144831.2-3960s21c1
Sequence:CCGGGGCTTTGGCCAGAGCCTTTAACTCGAGTTAAAGGCTCTGGCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2775s21c1
Sequence:CCGGAGCTTGTGGTGACACCTATTTCTCGAGAAATAGGTGTCACCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3239s21c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144831
VALIDATED
DHX8 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box polypeptide 8
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-374s1c1
Sequence:CCGGGATGCTAACTATCGTGTCCATCTCGAGATGGACACGATAGTTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-156s1c2
Sequence:CCGGCTCAAGGCCATGGGTATTAATCTCGAGATTAATACCCATGGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144831.1-905s1c1
Sequence:CCGGCAAAGTTTCTGACCCAACCAACTCGAGTTGGTTGGGTCAGAAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-444s1c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144831.1-608s1c1
Sequence:CCGGGTTAGGCATAATGGACAGGCACTCGAGTGCCTGTCCATTATGCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144831.1-776s1c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215343    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-3892s1c1
Sequence:CCGGCTGATCTTAAACTGAGCATTTCTCGAGAAATGCTCAGTTTAAGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144831.2-4144s1c1
Sequence:CCGGCAAGGGACATGAGTAACTGATCTCGAGATCAGTTACTCATGTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3571s21c1
Sequence:CCGGCAGTGCTCTCTTCAACAGACACTCGAGTGTCTGTTGAAGAGAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2408s21c1
Sequence:CCGGGAGCCGGAAACAGACTATTTGCTCGAGCAAATAGTCTGTTTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144831.2-3960s21c1
Sequence:CCGGGGCTTTGGCCAGAGCCTTTAACTCGAGTTAAAGGCTCTGGCCAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144831.2-2775s21c1
Sequence:CCGGAGCTTGTGGTGACACCTATTTCTCGAGAAATAGGTGTCACCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144831.2-3239s21c1
Sequence:CCGGGCAGATCAGAAGAAAGCCAAACTCGAGTTTGGCTTTCTTCTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks