EMAIL THIS PAGE TO A FRIEND

DHX9

DEAH (Asp-Glu-Ala-His) box helicase 9

73 Gene Product Result for
Synonyms: DDX9 LKP NDH2 NDHII RHA
Gene ID:
Human(1660) Summary: This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
Mouse(13211) DEAH (Asp-Glu-Ala-His) box polypeptide 9
Rat(304859) DEAH (Asp-Glu-Ala-His) box helicase 9
Zebrafish(568043) DEAH (Asp-Glu-Ala-His) box polypeptide 9
dog(480032) DEAH (Asp-Glu-Ala-His) box polypeptide 9
cow(281115) DEAH (Asp-Glu-Ala-His) box polypeptide 9
Horse(100055171) DEAH (Asp-Glu-Ala-His) box polypeptide 9
domestic cat(101090831) DEAH (Asp-Glu-Ala-His) box polypeptide 9
domestic guinea pig(100726314) DEAH (Asp-Glu-Ala-His) box helicase 9
naked mole-rat(101721209) DEAH (Asp-Glu-Ala-His) box helicase 9
sheep(101105091) DEAH (Asp-Glu-Ala-His) box polypeptide 9
Domestic Rabbit(100354085) DEAH (Asp-Glu-Ala-His) box polypeptide 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501243 Anti-DHX9 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB2107933 Anti-DHX9 antibody produced in rabbit affinity isolated antibody horse, rabbit, human, canine, rat, mouse, bovine, pig
immunohistochemistry, western blot pricing
AV36343 Anti-DHX9 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, rat, mouse, human, canine
immunohistochemistry, western blot pricing
HPA028050 Anti-DHX9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA055684 Anti-DHX9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0001660M1 Monoclonal Anti-DHX9 antibody produced in mouse clone 3G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403732 Monoclonal Anti-DHX9, (N-terminal) antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200639 Monoclonal Anti-DHX9/RHA antibody produced in rat clone 8E3, purified from hybridoma cell culture human, rat, canine, bovine, hamster, mouse, monkey
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001357 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109681 MISSION® esiRNA esiRNA human DHX9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001357 Rosetta Predictions human pricing
NM_001107184 Rosetta Predictions rat pricing
NM_007842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043890 predicted 2427
2 SASI_Hs01_00043891 predicted 3638
3 SASI_Hs01_00043892 predicted 3384
4 SASI_Hs01_00043893 predicted 584
5 SASI_Hs01_00043894 predicted 2681
6 SASI_Hs01_00043895 predicted 3925
7 SASI_Hs01_00043896 predicted 3369
8 SASI_Hs01_00043897 predicted 3219
9 SASI_Hs01_00043898 predicted 2855
10 SASI_Hs02_00331693 predicted 3770
11 SASI_Hs01_00043889 predicted 3229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226335 predicted 3601
2 SASI_Rn02_00226336 predicted 2058
3 SASI_Rn02_00226337 predicted 1980
4 SASI_Rn02_00226338 predicted 3476
5 SASI_Rn02_00226339 predicted 583
6 SASI_Rn02_00226340 predicted 2317
7 SASI_Rn02_00226341 predicted 875
8 SASI_Rn02_00226342 predicted 1968
9 SASI_Rn02_00226343 predicted 1668
10 SASI_Rn02_00226344 predicted 2553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192266 predicted 1978
2 SASI_Mm01_00192267 predicted 2057
3 SASI_Mm01_00192268 predicted 3057
4 SASI_Mm02_00312597 predicted 2637
5 SASI_Mm01_00192269 predicted 1557
6 SASI_Mm01_00192270 predicted 1239
7 SASI_Mm02_00312598 predicted 634
8 SASI_Mm01_00192272 predicted 868
9 SASI_Mm01_00192273 predicted 353
10 SASI_Mm01_00192274 predicted 2547
11 SASI_Mm01_00192271 predicted 1376
12 SASI_Mm01_00192275 predicted 2278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001357
VALIDATED
DHX9 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-2863s21c1
Sequence:CCGGGGGCTATATCCATCGAAATTTCTCGAGAAATTTCGATGGATATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001357.3-598s21c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-1603s21c1
Sequence:CCGGTCGTCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-4112s21c1
Sequence:CCGGTTAAGGAAACCAAGCATATAGCTCGAGCTATATGCTTGGTTTCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-3663s21c1
Sequence:CCGGACGACAATGGAAGCGGATATACTCGAGTATATCCGCTTCCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001357.x-4160s1c1
Sequence:CCGGGGCTTTCGTTTAATACAATAGCTCGAGCTATTGTATTAAACGAAAGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-2907s1c1
Sequence:CCGGAGACTTAATATGGCTACACTACTCGAGTAGTGTAGCCATATTAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-1586s1c1
Sequence:CCGGTCGAGGAATCAGTCATGTAATCTCGAGATTACATGACTGATTCCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-515s1c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-1414s1c1
Sequence:CCGGCCAGAAGAATCAGTGCGGTTTCTCGAGAAACCGCACTGATTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001357
VALIDATED
DHX9 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-2863s21c1
Sequence:CCGGGGGCTATATCCATCGAAATTTCTCGAGAAATTTCGATGGATATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001357.3-598s21c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-1603s21c1
Sequence:CCGGTCGTCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-4112s21c1
Sequence:CCGGTTAAGGAAACCAAGCATATAGCTCGAGCTATATGCTTGGTTTCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-3663s21c1
Sequence:CCGGACGACAATGGAAGCGGATATACTCGAGTATATCCGCTTCCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001357.x-4160s1c1
Sequence:CCGGGGCTTTCGTTTAATACAATAGCTCGAGCTATTGTATTAAACGAAAGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-2907s1c1
Sequence:CCGGAGACTTAATATGGCTACACTACTCGAGTAGTGTAGCCATATTAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-1586s1c1
Sequence:CCGGTCGAGGAATCAGTCATGTAATCTCGAGATTACATGACTGATTCCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-515s1c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-1414s1c1
Sequence:CCGGCCAGAAGAATCAGTGCGGTTTCTCGAGAAACCGCACTGATTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001357
VALIDATED
DHX9 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-2863s21c1
Sequence:CCGGGGGCTATATCCATCGAAATTTCTCGAGAAATTTCGATGGATATAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001357.3-598s21c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-1603s21c1
Sequence:CCGGTCGTCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-4112s21c1
Sequence:CCGGTTAAGGAAACCAAGCATATAGCTCGAGCTATATGCTTGGTTTCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001357.3-3663s21c1
Sequence:CCGGACGACAATGGAAGCGGATATACTCGAGTATATCCGCTTCCATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001357.x-4160s1c1
Sequence:CCGGGGCTTTCGTTTAATACAATAGCTCGAGCTATTGTATTAAACGAAAGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-2907s1c1
Sequence:CCGGAGACTTAATATGGCTACACTACTCGAGTAGTGTAGCCATATTAAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-1586s1c1
Sequence:CCGGTCGAGGAATCAGTCATGTAATCTCGAGATTACATGACTGATTCCTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001357.x-515s1c1
Sequence:CCGGGAAGGATTACTACTCAAGAAACTCGAGTTTCTTGAGTAGTAATCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001357.x-1414s1c1
Sequence:CCGGCCAGAAGAATCAGTGCGGTTTCTCGAGAAACCGCACTGATTCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007842
VALIDATED
DHX9 MISSION shRNA Bacterial Glycerol Stock
DEAH (Asp-Glu-Ala-His) box helicase 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-574s21c1
Sequence:CCGGGACCGAGGAGCCAACCTTAAACTCGAGTTTAAGGTTGGCTCCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2071s21c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007842.2-4387s21c1
Sequence:CCGGTAAACCCATTTCCCACTTAATCTCGAGATTAAGTGGGAAATGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2267s21c1
Sequence:CCGGATGGAGTAACCAAGGTTATTTCTCGAGAAATAACCTTGGTTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-1596s21c1
Sequence:CCGGACGCCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-3540s1c1
Sequence:CCGGGCTGGTATCAACCTTATGATTCTCGAGAATCATAAGGTTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-165s1c1
Sequence:CCGGGCCTATGAAATTAGAGCAGTACTCGAGTACTGCTCTAATTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2199s1c1
Sequence:CCGGCGCAAAGTGTTTGATCCAGTACTCGAGTACTGGATCAAACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-1113s1c1
Sequence:CCGGCCTCCACAATCCAACTGGAATCTCGAGATTCCAGTTGGATTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2028s1c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007842
VALIDATED
DHX9 MISSION shRNA shRNA Plasmid DNA
DEAH (Asp-Glu-Ala-His) box helicase 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-574s21c1
Sequence:CCGGGACCGAGGAGCCAACCTTAAACTCGAGTTTAAGGTTGGCTCCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2071s21c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007842.2-4387s21c1
Sequence:CCGGTAAACCCATTTCCCACTTAATCTCGAGATTAAGTGGGAAATGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2267s21c1
Sequence:CCGGATGGAGTAACCAAGGTTATTTCTCGAGAAATAACCTTGGTTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-1596s21c1
Sequence:CCGGACGCCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-3540s1c1
Sequence:CCGGGCTGGTATCAACCTTATGATTCTCGAGAATCATAAGGTTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-165s1c1
Sequence:CCGGGCCTATGAAATTAGAGCAGTACTCGAGTACTGCTCTAATTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2199s1c1
Sequence:CCGGCGCAAAGTGTTTGATCCAGTACTCGAGTACTGGATCAAACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-1113s1c1
Sequence:CCGGCCTCCACAATCCAACTGGAATCTCGAGATTCCAGTTGGATTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2028s1c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007842
VALIDATED
DHX9 MISSION shRNA Lentiviral Transduction Particles
DEAH (Asp-Glu-Ala-His) box helicase 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-574s21c1
Sequence:CCGGGACCGAGGAGCCAACCTTAAACTCGAGTTTAAGGTTGGCTCCTCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2071s21c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007842.2-4387s21c1
Sequence:CCGGTAAACCCATTTCCCACTTAATCTCGAGATTAAGTGGGAAATGGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007842.2-2267s21c1
Sequence:CCGGATGGAGTAACCAAGGTTATTTCTCGAGAAATAACCTTGGTTACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007842.2-1596s21c1
Sequence:CCGGACGCCCTCATGCCAGTATAATCTCGAGATTATACTGGCATGAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-3540s1c1
Sequence:CCGGGCTGGTATCAACCTTATGATTCTCGAGAATCATAAGGTTGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-165s1c1
Sequence:CCGGGCCTATGAAATTAGAGCAGTACTCGAGTACTGCTCTAATTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2199s1c1
Sequence:CCGGCGCAAAGTGTTTGATCCAGTACTCGAGTACTGGATCAAACACTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007842.1-1113s1c1
Sequence:CCGGCCTCCACAATCCAACTGGAATCTCGAGATTCCAGTTGGATTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007842.1-2028s1c1
Sequence:CCGGGCGCTTCTTAAATACATTGAACTCGAGTTCAATGTATTTAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks