EMAIL THIS PAGE TO A FRIEND

DIABLO

diablo, IAP-binding mitochondrial protein

85 Gene Product Result for
Synonyms: DFNA64 SMAC
UniProtKB ID: Q9NR28, B2RDQ0, Q6W3F3, Q96LV0, Q9BT11, Q9HAV6
Gene ID:
Human(56616) Summary: This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Mouse(66593) diablo homolog (Drosophila)
Rat(288753) diablo, IAP-binding mitochondrial protein
chicken(416860) diablo, IAP-binding mitochondrial protein
cow(493999) diablo, IAP-binding mitochondrial protein
dog(477463) diablo, IAP-binding mitochondrial protein
sheep(101121971) diablo, IAP-binding mitochondrial protein
naked mole-rat(101708166) diablo, IAP-binding mitochondrial protein
domestic guinea pig(100724526) diablo, IAP-binding mitochondrial protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019887 Rosetta Predictions human pricing
NM_138929 Rosetta Predictions human pricing
NM_138930 Rosetta Predictions human pricing
NM_001008292 Rosetta Predictions rat pricing
NM_023232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168383 predicted 557
2 SASI_Hs01_00168385 predicted 728
3 SASI_Hs02_00352899 predicted 566
4 SASI_Hs01_00168386 predicted 565
5 SASI_Hs01_00168387 predicted 581
6 SASI_Hs01_00168388 predicted 563
7 SASI_Hs01_00168389 predicted 560
8 SASI_Hs01_00168390 predicted 735
9 SASI_Hs01_00168391 predicted 552
10 SASI_Hs01_00168392 predicted 556
11 SASI_Hs01_00168384 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049454 predicted 422
2 SASI_Hs01_00049456 predicted 603
3 SASI_Hs02_00364004 predicted 437
4 SASI_Hs01_00049457 predicted 432
5 SASI_Hs01_00049458 predicted 456
6 SASI_Hs01_00049459 predicted 426
7 SASI_Hs01_00049460 predicted 430
8 SASI_Hs01_00049461 predicted 599
9 SASI_Hs01_00049462 predicted 421
10 SASI_Hs01_00049463 predicted 425
11 SASI_Hs01_00049455 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217709 predicted 529
2 SASI_Hs01_00217711 predicted 707
3 SASI_Hs02_00364005 predicted 536
4 SASI_Hs01_00217712 predicted 536
5 SASI_Hs01_00217713 predicted 552
6 SASI_Hs01_00217714 predicted 529
7 SASI_Hs01_00217715 predicted 534
8 SASI_Hs01_00217716 predicted 704
9 SASI_Hs01_00217717 predicted 532
10 SASI_Hs01_00217718 predicted 526
11 SASI_Hs01_00217710 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198996 predicted 1053
2 SASI_Rn01_00061713 predicted 560
3 SASI_Rn01_00061714 predicted 299
4 SASI_Rn01_00061715 predicted 924
5 SASI_Rn01_00061716 predicted 267
6 SASI_Rn01_00061717 predicted 398
7 SASI_Rn02_00198997 predicted 408
8 SASI_Rn01_00061719 predicted 651
9 SASI_Rn01_00061720 predicted 819
10 SASI_Rn01_00061721 predicted 319
11 SASI_Rn01_00061718 predicted 556
12 SASI_Rn01_00061722 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190494 predicted 583
2 SASI_Mm01_00190495 predicted 568
3 SASI_Mm01_00190496 predicted 445
4 SASI_Mm01_00190497 predicted 428
5 SASI_Mm01_00190498 predicted 1046
6 SASI_Mm01_00190499 predicted 323
7 SASI_Mm01_00190500 predicted 217
8 SASI_Mm01_00190501 predicted 344
9 SASI_Mm01_00190502 predicted 364
10 SASI_Mm01_00190503 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019887
VALIDATED
DIABLO MISSION shRNA Bacterial Glycerol Stock
diablo, IAP-binding mitochondrial protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-205s1c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019887.x-1383s1c1
Sequence:CCGGCCGTTTCTCTATTGTATCCAACTCGAGTTGGATACAATAGAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-163s1c1
Sequence:CCGGGTGACGATTGGCTTTGGAGTACTCGAGTACTCCAAAGCCAATCGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019887.x-369s1c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-310s1c1
Sequence:CCGGGCGTTGATTGAAGCTATTACTCTCGAGAGTAATAGCTTCAATCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019887.4-1723s21c1
Sequence:CCGGTTGGGCACTGCACCCTGTTTACTCGAGTAAACAGGGTGCAGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1330s21c1
Sequence:CCGGCGCAGATCAGGCCTCTATAACCTCGAGGTTATAGAGGCCTGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-983s21c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1147s21c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1087s21c1
Sequence:CCGGTGCGTTGATTGAAGCTATTACCTCGAGGTAATAGCTTCAATCAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019887
VALIDATED
DIABLO MISSION shRNA shRNA Plasmid DNA
diablo, IAP-binding mitochondrial protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-205s1c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019887.x-1383s1c1
Sequence:CCGGCCGTTTCTCTATTGTATCCAACTCGAGTTGGATACAATAGAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-163s1c1
Sequence:CCGGGTGACGATTGGCTTTGGAGTACTCGAGTACTCCAAAGCCAATCGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019887.x-369s1c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-310s1c1
Sequence:CCGGGCGTTGATTGAAGCTATTACTCTCGAGAGTAATAGCTTCAATCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019887.4-1723s21c1
Sequence:CCGGTTGGGCACTGCACCCTGTTTACTCGAGTAAACAGGGTGCAGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1330s21c1
Sequence:CCGGCGCAGATCAGGCCTCTATAACCTCGAGGTTATAGAGGCCTGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-983s21c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1147s21c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1087s21c1
Sequence:CCGGTGCGTTGATTGAAGCTATTACCTCGAGGTAATAGCTTCAATCAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019887
VALIDATED
DIABLO MISSION shRNA Lentiviral Transduction Particles
diablo, IAP-binding mitochondrial protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-205s1c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019887.x-1383s1c1
Sequence:CCGGCCGTTTCTCTATTGTATCCAACTCGAGTTGGATACAATAGAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-163s1c1
Sequence:CCGGGTGACGATTGGCTTTGGAGTACTCGAGTACTCCAAAGCCAATCGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_019887.x-369s1c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019887.x-310s1c1
Sequence:CCGGGCGTTGATTGAAGCTATTACTCTCGAGAGTAATAGCTTCAATCAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019887.4-1723s21c1
Sequence:CCGGTTGGGCACTGCACCCTGTTTACTCGAGTAAACAGGGTGCAGTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1330s21c1
Sequence:CCGGCGCAGATCAGGCCTCTATAACCTCGAGGTTATAGAGGCCTGATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-983s21c1
Sequence:CCGGGCACAGAAATCAGAGCCTCATCTCGAGATGAGGCTCTGATTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1147s21c1
Sequence:CCGGCCGACAATATACAAGTTTACTCTCGAGAGTAAACTTGTATATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019887.4-1087s21c1
Sequence:CCGGTGCGTTGATTGAAGCTATTACCTCGAGGTAATAGCTTCAATCAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023232
VALIDATED
DIABLO MISSION shRNA Bacterial Glycerol Stock
diablo, IAP-binding mitochondrial protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-1252s1c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-261s1c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-448s1c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-371s1c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-199s1c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-205s21c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-267s21c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-1258s21c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023232.3-454s21c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-377s21c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023232
VALIDATED
DIABLO MISSION shRNA shRNA Plasmid DNA
diablo, IAP-binding mitochondrial protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-1252s1c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-261s1c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-448s1c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-371s1c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-199s1c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-205s21c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-267s21c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-1258s21c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023232.3-454s21c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-377s21c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023232
VALIDATED
DIABLO MISSION shRNA Lentiviral Transduction Particles
diablo, IAP-binding mitochondrial protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-1252s1c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-261s1c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-448s1c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-371s1c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023232.2-199s1c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-205s21c1
Sequence:CCGGCGGTTCCTATTGCTCAGAAATCTCGAGATTTCTGAGCAATAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-267s21c1
Sequence:CCGGGCTGTGTCTTTGGTAACAGATCTCGAGATCTGTTACCAAAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-1258s21c1
Sequence:CCGGGCCCTTCTCTAACACGTACTTCTCGAGAAGTACGTGTTAGAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023232.3-454s21c1
Sequence:CCGGCCAGAGTTGAGATGACTTCAACTCGAGTTGAAGTCATCTCAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023232.3-377s21c1
Sequence:CCGGGTACCGACAATATACAAGTTTCTCGAGAAACTTGTATATTGTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks