EMAIL THIS PAGE TO A FRIEND

DIAPH1

diaphanous-related formin 1

Synonyms: DFNA1 DIA1 DRF1 LFHL1 hDIA1
Gene ID:
Human(1729) Summary: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(307483) diaphanous-related formin 1
sheep(101106682) diaphanous homolog 1 (Drosophila)
domestic guinea pig(100724692) diaphanous-related formin 1
naked mole-rat(101708106) diaphanous-related formin 1
chicken(374040) diaphanous homolog 1 (Drosophila)
dog(100684883) diaphanous homolog 1 (Drosophila)
domestic cat(101101441) diaphanous homolog 1 (Drosophila)
Horse(100072186) diaphanous homolog 1 (Drosophila)
cow(786565) diaphanous-related formin 1
Gene Class: Cytoskeleton
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005219 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109471 MISSION® esiRNA esiRNA human DIAPH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079812 Rosetta Predictions human pricing
NM_005219 Rosetta Predictions human pricing
NM_001107393 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313790 predicted 2993
2 SASI_Hs02_00313791 predicted 816
3 SASI_Hs02_00313792 predicted 1271
4 SASI_Hs02_00313793 predicted 1397
5 SASI_Hs02_00313794 predicted 1627
6 SASI_Hs02_00313795 predicted 1110
7 SASI_Hs02_00313796 predicted 3331
8 SASI_Hs02_00313797 predicted 3149
9 SASI_Hs02_00313798 predicted 3382
10 SASI_Hs02_00313799 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096134 predicted 3024
2 SASI_Hs01_00096135 predicted 841
3 SASI_Hs02_00339204 predicted 1293
4 SASI_Hs01_00096137 predicted 1424
5 SASI_Hs01_00096138 predicted 1655
6 SASI_Hs01_00096139 predicted 1137
7 SASI_Hs02_00339205 predicted 3356
8 SASI_Hs01_00096140 predicted 3170
9 SASI_Hs01_00096142 predicted 3405
10 SASI_Hs01_00096143 predicted 1378
11 SASI_Hs01_00096136 predicted 206
12 SASI_Hs01_00096141 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228375 predicted 3065
2 SASI_Rn02_00228376 predicted 2959
3 SASI_Rn02_00228377 predicted 3128
4 SASI_Rn02_00228378 predicted 3242
5 SASI_Rn02_00228379 predicted 3484
6 SASI_Rn02_00228380 predicted 3252
7 SASI_Rn02_00228381 predicted 3320
8 SASI_Rn02_00228382 predicted 3105
9 SASI_Rn02_00228383 predicted 3346
10 SASI_Rn02_00228384 predicted 2970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005219
VALIDATED
DIAPH1 MISSION shRNA Bacterial Glycerol Stock
diaphanous-related formin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-4115s1c1
Sequence:CCGGCCTGACTTTCTAATGGGCTTTCTCGAGAAAGCCCATTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2557s1c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2523s1c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-564s1c1
Sequence:CCGGGCCTCCTTATTGGACATTCTTCTCGAGAAGAATGTCCAATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2562s1c1
Sequence:CCGGCCCTATCAAGAGATTAAGAATCTCGAGATTCTTAATCTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1209s21c1
Sequence:CCGGAGATATGAGAGTGCAACTAAACTCGAGTTTAGTTGCACTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1029s21c1
Sequence:CCGGGCCGCTGCTGGATGGATTAAACTCGAGTTTAATCCATCCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2710s21c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2744s21c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-4450s21c1
Sequence:CCGGCTCTCCTGGCTGTGGTTATTTCTCGAGAAATAACCACAGCCAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005219
VALIDATED
DIAPH1 MISSION shRNA shRNA Plasmid DNA
diaphanous-related formin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-4115s1c1
Sequence:CCGGCCTGACTTTCTAATGGGCTTTCTCGAGAAAGCCCATTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2557s1c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2523s1c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-564s1c1
Sequence:CCGGGCCTCCTTATTGGACATTCTTCTCGAGAAGAATGTCCAATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2562s1c1
Sequence:CCGGCCCTATCAAGAGATTAAGAATCTCGAGATTCTTAATCTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1209s21c1
Sequence:CCGGAGATATGAGAGTGCAACTAAACTCGAGTTTAGTTGCACTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1029s21c1
Sequence:CCGGGCCGCTGCTGGATGGATTAAACTCGAGTTTAATCCATCCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2710s21c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2744s21c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-4450s21c1
Sequence:CCGGCTCTCCTGGCTGTGGTTATTTCTCGAGAAATAACCACAGCCAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005219
VALIDATED
DIAPH1 MISSION shRNA Lentiviral Transduction Particles
diaphanous-related formin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-4115s1c1
Sequence:CCGGCCTGACTTTCTAATGGGCTTTCTCGAGAAAGCCCATTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2557s1c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2523s1c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-564s1c1
Sequence:CCGGGCCTCCTTATTGGACATTCTTCTCGAGAAGAATGTCCAATAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005219.2-2562s1c1
Sequence:CCGGCCCTATCAAGAGATTAAGAATCTCGAGATTCTTAATCTCTTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1209s21c1
Sequence:CCGGAGATATGAGAGTGCAACTAAACTCGAGTTTAGTTGCACTCTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-1029s21c1
Sequence:CCGGGCCGCTGCTGGATGGATTAAACTCGAGTTTAATCCATCCAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2710s21c1
Sequence:CCGGGCCCAGAATCTCTCAATCTTTCTCGAGAAAGATTGAGAGATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-2744s21c1
Sequence:CCGGGCATGCCCTATCAAGAGATTACTCGAGTAATCTCTTGATAGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005219.4-4450s21c1
Sequence:CCGGCTCTCCTGGCTGTGGTTATTTCTCGAGAAATAACCACAGCCAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks