EMAIL THIS PAGE TO A FRIEND

DIAPH2

diaphanous-related formin 2

Synonyms: DIA DIA2 DRF2 POF POF2
UniProtKB ID: O60879, A6NG19, O60878, Q8WX06, Q8WX48, Q9UJL2
Gene ID:
Human(1730) Summary: The product of this gene belongs to the diaphanous subfamily of the formin homology family of proteins. This gene may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Rat(317189) diaphanous-related formin 2
Zebrafish(556029) diaphanous homolog 2 (Drosophila)
domestic cat(101081123) diaphanous homolog 2 (Drosophila)
Horse(100057058) diaphanous homolog 2 (Drosophila)
cow(782964) diaphanous homolog 2 (Drosophila)
naked mole-rat(101713815) diaphanous-related formin 2
domestic guinea pig(100723370) diaphanous-related formin 2
Domestic Rabbit(100347936) diaphanous homolog 2 (Drosophila)
258 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006729 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088571 MISSION® esiRNA esiRNA human DIAPH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006729 Rosetta Predictions human pricing
NM_007309 Rosetta Predictions human pricing
XM_001066898 Rosetta Predictions rat pricing
XM_228441 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019994 predicted 2848
2 SASI_Hs01_00019995 predicted 751
3 SASI_Hs02_00342164 predicted 1757
4 SASI_Hs01_00019996 predicted 1778
5 SASI_Hs02_00342165 predicted 1708
6 SASI_Hs01_00019998 predicted 2709
7 SASI_Hs01_00019999 predicted 889
8 SASI_Hs01_00020000 predicted 1531
9 SASI_Hs01_00020001 predicted 617
10 SASI_Hs02_00342166 predicted 3199
11 SASI_Hs01_00019992 predicted 2620
12 SASI_Hs01_00019993 predicted 2547
13 SASI_Hs01_00019997 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087132 predicted 2851
2 SASI_Hs01_00087133 predicted 754
3 SASI_Hs02_00343377 predicted 1757
4 SASI_Hs01_00087134 predicted 1781
5 SASI_Hs02_00343378 predicted 1702
6 SASI_Hs01_00087136 predicted 2712
7 SASI_Hs01_00087137 predicted 892
8 SASI_Hs01_00087138 predicted 1530
9 SASI_Hs01_00087139 predicted 620
10 SASI_Hs02_00343379 predicted 3198
11 SASI_Hs01_00087130 predicted 2619
12 SASI_Hs01_00087131 predicted 2548
13 SASI_Hs01_00087135 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319112 predicted 2789
2 SASI_Rn02_00319113 predicted 529
3 SASI_Rn02_00319114 predicted 799
4 SASI_Rn02_00319115 predicted 1190
5 SASI_Rn02_00319116 predicted 2201
6 SASI_Rn02_00319117 predicted 239
7 SASI_Rn02_00319118 predicted 1142
8 SASI_Rn02_00319119 predicted 1254
9 SASI_Rn02_00319120 predicted 540
10 SASI_Rn02_00319121 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385062 predicted 204
2 SASI_Rn02_00385063 predicted 476
3 SASI_Rn02_00385064 predicted 865
4 SASI_Rn02_00385065 predicted 813
5 SASI_Rn02_00385066 predicted 1873
6 SASI_Rn02_00385067 predicted 942
7 SASI_Rn02_00385068 predicted 577
8 SASI_Rn02_00385069 predicted 936
9 SASI_Rn02_00385070 predicted 221
10 SASI_Rn02_00385071 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006729
VALIDATED
DIAPH2 MISSION shRNA Bacterial Glycerol Stock
diaphanous-related formin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006729.4-4170s21c1
Sequence:CCGGTTTGGAGAGAGGCTAATATTACTCGAGTAATATTAGCCTCTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2594s21c1
Sequence:CCGGACGTTATTCTGGAGGTTAATGCTCGAGCATTAACCTCCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-872s21c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2488s21c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006729.4-554s21c1
Sequence:CCGGATGATGTGCGTGACCGAATTACTCGAGTAATTCGGTCACGCACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006729.2-5198s1c1
Sequence:CCGGGCCCACAGATAATTCCTTTATCTCGAGATAAAGGAATTATCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-2442s1c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-2890s1c1
Sequence:CCGGGCTCAAGAAATGCCCAGTCTTCTCGAGAAGACTGGGCATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-3060s1c1
Sequence:CCGGGCAAGCAAAGTTTCAGCTCAACTCGAGTTGAGCTGAAACTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-826s1c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006729
VALIDATED
DIAPH2 MISSION shRNA shRNA Plasmid DNA
diaphanous-related formin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006729.4-4170s21c1
Sequence:CCGGTTTGGAGAGAGGCTAATATTACTCGAGTAATATTAGCCTCTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2594s21c1
Sequence:CCGGACGTTATTCTGGAGGTTAATGCTCGAGCATTAACCTCCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-872s21c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2488s21c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006729.4-554s21c1
Sequence:CCGGATGATGTGCGTGACCGAATTACTCGAGTAATTCGGTCACGCACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006729.2-5198s1c1
Sequence:CCGGGCCCACAGATAATTCCTTTATCTCGAGATAAAGGAATTATCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-2442s1c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-2890s1c1
Sequence:CCGGGCTCAAGAAATGCCCAGTCTTCTCGAGAAGACTGGGCATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-3060s1c1
Sequence:CCGGGCAAGCAAAGTTTCAGCTCAACTCGAGTTGAGCTGAAACTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-826s1c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006729
VALIDATED
DIAPH2 MISSION shRNA Lentiviral Transduction Particles
diaphanous-related formin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006729.4-4170s21c1
Sequence:CCGGTTTGGAGAGAGGCTAATATTACTCGAGTAATATTAGCCTCTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2594s21c1
Sequence:CCGGACGTTATTCTGGAGGTTAATGCTCGAGCATTAACCTCCAGAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-872s21c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006729.4-2488s21c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006729.4-554s21c1
Sequence:CCGGATGATGTGCGTGACCGAATTACTCGAGTAATTCGGTCACGCACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006729.2-5198s1c1
Sequence:CCGGGCCCACAGATAATTCCTTTATCTCGAGATAAAGGAATTATCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-2442s1c1
Sequence:CCGGCCTACAAAGAAGAAAGTGAAACTCGAGTTTCACTTTCTTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-2890s1c1
Sequence:CCGGGCTCAAGAAATGCCCAGTCTTCTCGAGAAGACTGGGCATTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006729.2-3060s1c1
Sequence:CCGGGCAAGCAAAGTTTCAGCTCAACTCGAGTTGAGCTGAAACTTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006729.2-826s1c1
Sequence:CCGGGCACCCTGTCTTCACAAGAATCTCGAGATTCTTGTGAAGACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks