EMAIL THIS PAGE TO A FRIEND

DIAPH3

diaphanous-related formin 3

110 Gene Product Result for
Synonyms: AN AUNA1 DIA2 DRF3 NSDAN diap3 mDia2
Gene ID:
Human(81624) Summary: This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Rat(290396) diaphanous-related formin 3
domestic guinea pig(100733267) diaphanous homolog 3 (Drosophila)
naked mole-rat(101709465) diaphanous homolog 3 (Drosophila)
Zebrafish(445230) diaphanous homolog 3 (Drosophila)
chicken(418824) diaphanous homolog 3 (Drosophila)
cow(525628) diaphanous-related formin 3
Horse(100051814) diaphanous homolog 3 (Drosophila)
domestic cat(101095543) diaphanous homolog 3 (Drosophila)
dog(485474) diaphanous homolog 3 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030932 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090271 MISSION® esiRNA esiRNA human DIAPH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042517 Rosetta Predictions human pricing
NM_030932 Rosetta Predictions human pricing
XM_001074393 Rosetta Predictions rat pricing
XM_224392 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310288 predicted 1407
2 SASI_Hs02_00310289 predicted 2575
3 SASI_Hs02_00310290 predicted 2918
4 SASI_Hs02_00310291 predicted 2794
5 SASI_Hs02_00310292 predicted 2929
6 SASI_Hs02_00310293 predicted 1506
7 SASI_Hs02_00310294 predicted 2669
8 SASI_Hs02_00310295 predicted 1619
9 SASI_Hs02_00310296 predicted 1605
10 SASI_Hs02_00310297 predicted 2563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189948 predicted 575
2 SASI_Hs01_00189949 predicted 1742
3 SASI_Hs01_00189952 predicted 2092
4 SASI_Hs01_00189953 predicted 1967
5 SASI_Hs01_00189954 predicted 2096
6 SASI_Hs01_00189955 predicted 675
7 SASI_Hs01_00189956 predicted 1835
8 SASI_Hs01_00189957 predicted 788
9 SASI_Hs02_00358493 predicted 773
10 SASI_Hs02_00358494 predicted 1738
11 SASI_Hs01_00189950 predicted 705
12 SASI_Hs01_00189951 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346050 predicted 1028
2 SASI_Rn02_00346051 predicted 1138
3 SASI_Rn02_00346052 predicted 1625
4 SASI_Rn02_00346053 predicted 612
5 SASI_Rn02_00346054 predicted 2177
6 SASI_Rn02_00346055 predicted 2590
7 SASI_Rn02_00346056 predicted 2264
8 SASI_Rn02_00346057 predicted 511
9 SASI_Rn02_00346058 predicted 931
10 SASI_Rn02_00346059 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381948 predicted 1037
2 SASI_Rn02_00381949 predicted 1148
3 SASI_Rn02_00381950 predicted 1635
4 SASI_Rn02_00381951 predicted 2153
5 SASI_Rn02_00381952 predicted 2293
6 SASI_Rn02_00381953 predicted 2568
7 SASI_Rn02_00381954 predicted 2245
8 SASI_Rn02_00381955 predicted 937
9 SASI_Rn02_00381956 predicted 2276
10 SASI_Rn02_00381957 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030932
VALIDATED
DIAPH3 MISSION shRNA Bacterial Glycerol Stock
diaphanous-related formin 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1922s1c1
Sequence:CCGGCCTTCGGATTTAACCTTAGCTCTCGAGAGCTAAGGTTAAATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-2363s1c1
Sequence:CCGGCCACATTCATGCAAGCAATAACTCGAGTTATTGCTTGCATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2425s1c1
Sequence:CCGGCGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-1743s1c1
Sequence:CCGGGCTCAGTGCTATTCTCTTTAACTCGAGTTAAAGAGAATAGCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-2194s1c1
Sequence:CCGGGTGACAAAGATGTCCAGATTTCTCGAGAAATCTGGACATCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2181s1c1
Sequence:CCGGGCATGACAAGTTTGTGACAAACTCGAGTTTGTCACAAACTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-1280s1c1
Sequence:CCGGGCATGAGAAGATTGAATTGGTCTCGAGACCAATTCAATCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030932.2-2207s1c1
Sequence:CCGGCCAGATTTGTTATCAGTGCAACTCGAGTTGCACTGATAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-395s1c1
Sequence:CCGGCATCTCCTGATGATTTGGATTCTCGAGAATCCAAATCATCAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1788s1c1
Sequence:CCGGCAACATCAAACCTGACATCATCTCGAGATGATGTCAGGTTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-364s1c1
Sequence:CCGGGCTTGTATGCAGCTCATCAATCTCGAGATTGATGAGCTGCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-211s1c1
Sequence:CCGGGTTAAACTTCTCTCTGCGGTACTCGAGTACCGCAGAGAGAAGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-539s21c1
Sequence:CCGGTGGCCTGGATATCCAACTTAACTCGAGTTAAGTTGGATATCCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-2706s21c1
Sequence:CCGCCATGGTAATAAACCGTATTTACTCGAGTAAATACGGTTTATTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-725s21c1
Sequence:CCGGGCTGATTCGAAATGATTATTTCTCGAGAAATAATCATTTCGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030932
VALIDATED
DIAPH3 MISSION shRNA shRNA Plasmid DNA
diaphanous-related formin 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1922s1c1
Sequence:CCGGCCTTCGGATTTAACCTTAGCTCTCGAGAGCTAAGGTTAAATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-2363s1c1
Sequence:CCGGCCACATTCATGCAAGCAATAACTCGAGTTATTGCTTGCATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2425s1c1
Sequence:CCGGCGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-1743s1c1
Sequence:CCGGGCTCAGTGCTATTCTCTTTAACTCGAGTTAAAGAGAATAGCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-2194s1c1
Sequence:CCGGGTGACAAAGATGTCCAGATTTCTCGAGAAATCTGGACATCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2181s1c1
Sequence:CCGGGCATGACAAGTTTGTGACAAACTCGAGTTTGTCACAAACTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-1280s1c1
Sequence:CCGGGCATGAGAAGATTGAATTGGTCTCGAGACCAATTCAATCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030932.2-2207s1c1
Sequence:CCGGCCAGATTTGTTATCAGTGCAACTCGAGTTGCACTGATAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-395s1c1
Sequence:CCGGCATCTCCTGATGATTTGGATTCTCGAGAATCCAAATCATCAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1788s1c1
Sequence:CCGGCAACATCAAACCTGACATCATCTCGAGATGATGTCAGGTTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-364s1c1
Sequence:CCGGGCTTGTATGCAGCTCATCAATCTCGAGATTGATGAGCTGCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-211s1c1
Sequence:CCGGGTTAAACTTCTCTCTGCGGTACTCGAGTACCGCAGAGAGAAGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-539s21c1
Sequence:CCGGTGGCCTGGATATCCAACTTAACTCGAGTTAAGTTGGATATCCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-2706s21c1
Sequence:CCGCCATGGTAATAAACCGTATTTACTCGAGTAAATACGGTTTATTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-725s21c1
Sequence:CCGGGCTGATTCGAAATGATTATTTCTCGAGAAATAATCATTTCGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030932
VALIDATED
DIAPH3 MISSION shRNA Lentiviral Transduction Particles
diaphanous-related formin 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1922s1c1
Sequence:CCGGCCTTCGGATTTAACCTTAGCTCTCGAGAGCTAAGGTTAAATCCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-2363s1c1
Sequence:CCGGCCACATTCATGCAAGCAATAACTCGAGTTATTGCTTGCATGAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2425s1c1
Sequence:CCGGCGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-1743s1c1
Sequence:CCGGGCTCAGTGCTATTCTCTTTAACTCGAGTTAAAGAGAATAGCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-2194s1c1
Sequence:CCGGGTGACAAAGATGTCCAGATTTCTCGAGAAATCTGGACATCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-2181s1c1
Sequence:CCGGGCATGACAAGTTTGTGACAAACTCGAGTTTGTCACAAACTTGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-1280s1c1
Sequence:CCGGGCATGAGAAGATTGAATTGGTCTCGAGACCAATTCAATCTTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030932.2-2207s1c1
Sequence:CCGGCCAGATTTGTTATCAGTGCAACTCGAGTTGCACTGATAACAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-395s1c1
Sequence:CCGGCATCTCCTGATGATTTGGATTCTCGAGAATCCAAATCATCAGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030932.2-1788s1c1
Sequence:CCGGCAACATCAAACCTGACATCATCTCGAGATGATGTCAGGTTTGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030932.2-364s1c1
Sequence:CCGGGCTTGTATGCAGCTCATCAATCTCGAGATTGATGAGCTGCATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030932.2-211s1c1
Sequence:CCGGGTTAAACTTCTCTCTGCGGTACTCGAGTACCGCAGAGAGAAGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-539s21c1
Sequence:CCGGTGGCCTGGATATCCAACTTAACTCGAGTTAAGTTGGATATCCAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-2706s21c1
Sequence:CCGCCATGGTAATAAACCGTATTTACTCGAGTAAATACGGTTTATTACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030932.3-725s21c1
Sequence:CCGGGCTGATTCGAAATGATTATTTCTCGAGAAATAATCATTTCGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks