EMAIL THIS PAGE TO A FRIEND

DICER1

dicer 1, ribonuclease type III

199 Gene Product Result for
Synonyms: DCR1 Dicer HERNA MNG1
UniProtKB ID: Q9UPY3, A7E2D3, E0AD28, O95943, Q9UQ02
Gene ID:
Human(23405) Summary: This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(192119) dicer 1, ribonuclease type III
Rat(299284) dicer 1, ribonuclease type III
sheep(101120020) dicer 1, ribonuclease type III
naked mole-rat(101721048) dicer 1, ribonuclease type III
domestic guinea pig(100723975) dicer 1, ribonuclease type III
Zebrafish(324724) Dicer1, Dcr-1 homolog (Drosophila)
chicken(423437) dicer 1, ribonuclease type III
domestic cat(101089449) dicer 1, ribonuclease type III
cow(337871) dicer 1, ribonuclease type III
Horse(100065648) dicer 1, ribonuclease type III
dog(480426) dicer 1, ribonuclease type III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200087 Anti-Dicer antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody immunofluorescence, immunoprecipitation, western blot pricing
HPA000694 Anti-DICER1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200663 Monoclonal Anti-Dicer - Alkaline Phosphatase antibody produced in mouse clone S167-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200664 Monoclonal Anti-Dicer - Apc antibody produced in mouse clone S167-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200655 Monoclonal Anti-Dicer - Atto 390 antibody produced in mouse clone S167-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200656 Monoclonal Anti-Dicer - Atto 488 antibody produced in mouse clone S167-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200657 Monoclonal Anti-Dicer - Atto 565 antibody produced in mouse clone S167-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200658 Monoclonal Anti-Dicer - Atto 594 antibody produced in mouse clone S167-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5200659 Monoclonal Anti-Dicer - Atto 633 antibody produced in mouse clone S167-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200660 Monoclonal Anti-Dicer - Atto 655 antibody produced in mouse clone S167-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200661 Monoclonal Anti-Dicer - Atto 680 antibody produced in mouse clone S167-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200662 Monoclonal Anti-Dicer - Atto 700 antibody produced in mouse clone S167-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200665 Monoclonal Anti-Dicer - Biotin antibody produced in mouse clone S167-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200666 Monoclonal Anti-Dicer - Fitc antibody produced in mouse clone S167-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200667 Monoclonal Anti-Dicer - Hrp antibody produced in mouse clone S167-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200668 Monoclonal Anti-Dicer - Pe/Atto 594 antibody produced in mouse clone S167-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200669 Monoclonal Anti-Dicer - Percp antibody produced in mouse clone S167-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200670 Monoclonal Anti-Dicer - Rpe antibody produced in mouse clone S167-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200671 Monoclonal Anti-Dicer - Streptavidin antibody produced in mouse clone S167-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200654 Monoclonal Anti-Dicer antibody produced in mouse clone S167-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
WH0023405M1 Monoclonal Anti-DICER1 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
D0571 Monoclonal Anti-DICER1 antibody produced in mouse ~1.0 mg/mL, clone DCR1, purified immunoglobulin, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1404971 Monoclonal Anti-DICER1 antibody produced in mouse clone 2F12, ascites fluid human
ELISA, western blot pricing
AMAB90737 Monoclonal Anti-DICER1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0378, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030621 Rosetta Predictions human pricing
NM_177438 Rosetta Predictions human pricing
XM_001068155 Rosetta Predictions rat pricing
XM_001069041 Rosetta Predictions rat pricing
XM_216776 Rosetta Predictions rat pricing
NM_148948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160748 predicted 1975
2 SASI_Hs01_00160749 predicted 3732
3 SASI_Hs02_00358175 predicted 3796
4 SASI_Hs01_00160750 predicted 782
5 SASI_Hs01_00160751 predicted 1594
6 SASI_Hs01_00160752 predicted 4058
7 SASI_Hs01_00160753 predicted 936
8 SASI_Hs02_00358176 predicted 662
9 SASI_Hs01_00160756 predicted 2224
10 SASI_Hs01_00160757 predicted 3341
11 SASI_Hs01_00160754 predicted 635
12 SASI_Hs01_00160755 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130221 predicted 2033
2 SASI_Hs01_00130222 predicted 3794
3 SASI_Hs02_00369335 predicted 3850
4 SASI_Hs01_00130223 predicted 840
5 SASI_Hs01_00130224 predicted 1650
6 SASI_Hs01_00130225 predicted 4112
7 SASI_Hs01_00130226 predicted 999
8 SASI_Hs01_00130229 predicted 1375
9 SASI_Hs01_00130230 predicted 2275
10 SASI_Hs02_00369336 predicted 3402
11 SASI_Hs01_00130227 predicted 696
12 SASI_Hs01_00130228 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323641 predicted 2128
2 SASI_Rn02_00323642 predicted 5090
3 SASI_Rn02_00323643 predicted 799
4 SASI_Rn02_00323644 predicted 3440
5 SASI_Rn02_00323645 predicted 648
6 SASI_Rn02_00323646 predicted 1291
7 SASI_Rn02_00323647 predicted 2118
8 SASI_Rn02_00323648 predicted 1556
9 SASI_Rn02_00323649 predicted 775
10 SASI_Rn02_00323650 predicted 2105
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326710 predicted 2188
2 SASI_Rn02_00326711 predicted 5145
3 SASI_Rn02_00326712 predicted 858
4 SASI_Rn02_00326713 predicted 3493
5 SASI_Rn02_00326714 predicted 699
6 SASI_Rn02_00326715 predicted 1342
7 SASI_Rn02_00326716 predicted 2169
8 SASI_Rn02_00326717 predicted 1610
9 SASI_Rn02_00326718 predicted 838
10 SASI_Rn02_00326719 predicted 2159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153071 predicted 3790
2 SASI_Rn01_00153072 predicted 997
3 SASI_Rn01_00153073 predicted 5134
4 SASI_Rn01_00153074 predicted 842
5 SASI_Rn01_00153075 predicted 3480
6 SASI_Rn01_00153076 predicted 695
7 SASI_Rn01_00153077 predicted 1339
8 SASI_Rn01_00153078 predicted 4208
9 SASI_Rn01_00153079 predicted 6081
10 SASI_Rn01_00153080 predicted 2164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122553 predicted 1870
2 SASI_Mm01_00122555 predicted 565
3 SASI_Mm01_00122556 predicted 5176
4 SASI_Mm01_00122557 predicted 3490
5 SASI_Mm01_00122558 predicted 2166
6 SASI_Mm01_00122559 predicted 832
7 SASI_Mm01_00122560 predicted 2165
8 SASI_Mm01_00122561 predicted 3655
9 SASI_Mm02_00342772 predicted 5923
10 SASI_Mm01_00122562 predicted 3756
11 SASI_Mm01_00122554 predicted 3820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148948
VALIDATED
DICER1 MISSION shRNA Bacterial Glycerol Stock
dicer 1, ribonuclease type III
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2736s21c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-4350s21c1
Sequence:CCGGCCGCATGGTGGTGTCGATATTCTCGAGAATATCGACACCACCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-1213s21c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2218s21c1
Sequence:CCGGGAATTGCCTGATGGTACATTTCTCGAGAAATGTACCATCAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148948.2-6398s21c1
Sequence:CCGGTTGCGGTCCCTTACACTATACCTCGAGGTATAGTGTAAGGGACCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-5745s1c1
Sequence:CCGGCCGATGATGCAGCCTCTAATACTCGAGTATTAGAGGCTGCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1353s1c1
Sequence:CCGGGCCTCACTTGACCTGAAGTATCTCGAGATACTTCAGGTCAAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-4041s1c1
Sequence:CCGGCCTGCCATGATGAATGCTGTTCTCGAGAACAGCATTCATCATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-2744s1c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1221s1c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148948
VALIDATED
DICER1 MISSION shRNA shRNA Plasmid DNA
dicer 1, ribonuclease type III
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2736s21c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-4350s21c1
Sequence:CCGGCCGCATGGTGGTGTCGATATTCTCGAGAATATCGACACCACCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-1213s21c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2218s21c1
Sequence:CCGGGAATTGCCTGATGGTACATTTCTCGAGAAATGTACCATCAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148948.2-6398s21c1
Sequence:CCGGTTGCGGTCCCTTACACTATACCTCGAGGTATAGTGTAAGGGACCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-5745s1c1
Sequence:CCGGCCGATGATGCAGCCTCTAATACTCGAGTATTAGAGGCTGCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1353s1c1
Sequence:CCGGGCCTCACTTGACCTGAAGTATCTCGAGATACTTCAGGTCAAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-4041s1c1
Sequence:CCGGCCTGCCATGATGAATGCTGTTCTCGAGAACAGCATTCATCATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-2744s1c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1221s1c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148948
VALIDATED
DICER1 MISSION shRNA Lentiviral Transduction Particles
dicer 1, ribonuclease type III
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2736s21c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-4350s21c1
Sequence:CCGGCCGCATGGTGGTGTCGATATTCTCGAGAATATCGACACCACCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-1213s21c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148948.2-2218s21c1
Sequence:CCGGGAATTGCCTGATGGTACATTTCTCGAGAAATGTACCATCAGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148948.2-6398s21c1
Sequence:CCGGTTGCGGTCCCTTACACTATACCTCGAGGTATAGTGTAAGGGACCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-5745s1c1
Sequence:CCGGCCGATGATGCAGCCTCTAATACTCGAGTATTAGAGGCTGCATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1353s1c1
Sequence:CCGGGCCTCACTTGACCTGAAGTATCTCGAGATACTTCAGGTCAAGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-4041s1c1
Sequence:CCGGCCTGCCATGATGAATGCTGTTCTCGAGAACAGCATTCATCATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-2744s1c1
Sequence:CCGGCGAGCTGAAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148948.1-1221s1c1
Sequence:CCGGGCTGGGATGATGGTAAGAGAACTCGAGTTCTCTTACCATCATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030621
VALIDATED
DICER1 MISSION shRNA Bacterial Glycerol Stock
dicer 1, ribonuclease type III
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3772s21c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-1322s21c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3155s21c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5001s21c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5423s21c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-1322s1c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3155s1c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5423s1c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3772s1c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5001s1c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030621
VALIDATED
DICER1 MISSION shRNA shRNA Plasmid DNA
dicer 1, ribonuclease type III
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3772s21c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-1322s21c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3155s21c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5001s21c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5423s21c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-1322s1c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3155s1c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5423s1c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3772s1c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5001s1c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030621
VALIDATED
DICER1 MISSION shRNA Lentiviral Transduction Particles
dicer 1, ribonuclease type III
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3772s21c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-1322s21c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-3155s21c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5001s21c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_030621.3-5423s21c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-1322s1c1
Sequence:CCGGGCTCGAAATCTTACGCAAATACTCGAGTATTTGCGTAAGATTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3155s1c1
Sequence:CCGGCCACACATCTTCAAGACTTAACTCGAGTTAAGTCTTGAAGATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5423s1c1
Sequence:CCGGGCTGGCTGTAAAGTACGACTACTCGAGTAGTCGTACTTTACAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-3772s1c1
Sequence:CCGGGCCAAGGAAATCAGCTAAATTCTCGAGAATTTAGCTGATTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030621.2-5001s1c1
Sequence:CCGGCGGGAGAATTTCAACAGCCAACTCGAGTTGGCTGTTGAAATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks