EMAIL THIS PAGE TO A FRIEND

DIDO1

death inducer-obliterator 1

199 Gene Product Result for
Synonyms: BYE1 C20orf158 DATF-1 DATF1 DIDO2 DIDO3 DIO-1 DIO1 dJ885L7.8
Gene ID:
Human(11083) Summary: Apoptosis, a major form of cell death, is an efficient mechanism for eliminating unwanted cells and is of central importance for development and homeostasis in metazoan animals. In mice, the death inducer-obliterator-1 gene is upregulated by apoptotic signals and encodes a cytoplasmic protein that translocates to the nucleus upon apoptotic signal activation. When overexpressed, the mouse protein induced apoptosis in cell lines growing in vitro. This gene is similar to the mouse gene and therefore is thought to be involved in apoptosis. Alternatively spliced transcripts have been found for this gene, encoding multiple isoforms. [provided by RefSeq, Jul 2008]
Mouse(23856) death inducer-obliterator 1
Rat(362286) death inducer-obliterator 1
Zebrafish(553277) death inducer-obliterator 1
cow(519826) death inducer-obliterator 1
Horse(100058738) death inducer-obliterator 1
domestic cat(101081374) death inducer-obliterator 1
dog(485965) death inducer-obliterator 1
chicken(419234) death inducer-obliterator 1
domestic guinea pig(100734489) death inducer-obliterator 1
naked mole-rat(101708491) death inducer-obliterator 1
sheep(101119661) death inducer-obliterator 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022105 Rosetta Predictions human pricing
NM_033081 Rosetta Predictions human pricing
NM_080796 Rosetta Predictions human pricing
NM_080797 Rosetta Predictions human pricing
NM_001108612 Rosetta Predictions rat pricing
NM_011805 Rosetta Predictions mouse pricing
NM_175551 Rosetta Predictions mouse pricing
NM_177852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059476 predicted 1146
2 SASI_Hs01_00059477 predicted 1164
3 SASI_Hs01_00059478 predicted 665
4 SASI_Hs01_00059480 predicted 1261
5 SASI_Hs02_00355494 predicted 1365
6 SASI_Hs01_00059481 predicted 804
7 SASI_Hs01_00059482 predicted 1301
8 SASI_Hs02_00355495 predicted 369
9 SASI_Hs01_00059483 predicted 1267
10 SASI_Hs01_00059484 predicted 1439
11 SASI_Hs01_00059479 predicted 1032
12 SASI_Hs01_00059485 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142165 predicted 1149
2 SASI_Hs01_00142166 predicted 1164
3 SASI_Hs01_00142167 predicted 664
4 SASI_Hs01_00142169 predicted 1261
5 SASI_Hs02_00360780 predicted 1367
6 SASI_Hs01_00142170 predicted 801
7 SASI_Hs01_00142171 predicted 1306
8 SASI_Hs02_00360781 predicted 367
9 SASI_Hs01_00142172 predicted 1268
10 SASI_Hs01_00142173 predicted 1440
11 SASI_Hs01_00142168 predicted 1034
12 SASI_Hs01_00142174 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137894 predicted 1087
2 SASI_Hs01_00137895 predicted 1102
3 SASI_Hs01_00137896 predicted 595
4 SASI_Hs01_00137898 predicted 1190
5 SASI_Hs02_00362560 predicted 1298
6 SASI_Hs01_00137899 predicted 731
7 SASI_Hs01_00137900 predicted 1235
8 SASI_Hs02_00362561 predicted 304
9 SASI_Hs01_00137901 predicted 1209
10 SASI_Hs01_00137902 predicted 1373
11 SASI_Hs01_00137897 predicted 960
12 SASI_Hs01_00137903 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088454 predicted 1143
2 SASI_Hs01_00088455 predicted 1171
3 SASI_Hs01_00088456 predicted 667
4 SASI_Hs01_00088458 predicted 1253
5 SASI_Hs02_00362562 predicted 1363
6 SASI_Hs01_00088459 predicted 796
7 SASI_Hs01_00088460 predicted 1297
8 SASI_Hs02_00362563 predicted 362
9 SASI_Hs01_00088461 predicted 1269
10 SASI_Hs01_00088462 predicted 1443
11 SASI_Hs01_00088457 predicted 1028
12 SASI_Hs01_00088463 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240349 predicted 1250
2 SASI_Rn02_00240350 predicted 490
3 SASI_Rn02_00240351 predicted 1826
4 SASI_Rn02_00240352 predicted 897
5 SASI_Rn02_00240353 predicted 1818
6 SASI_Rn02_00240354 predicted 1525
7 SASI_Rn02_00240355 predicted 1580
8 SASI_Rn02_00240356 predicted 1876
9 SASI_Rn02_00240357 predicted 1758
10 SASI_Rn02_00240358 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114191 predicted 1551
2 SASI_Mm01_00114192 predicted 1142
3 SASI_Mm01_00114193 predicted 1404
4 SASI_Mm01_00114194 predicted 1542
5 SASI_Mm01_00114195 predicted 1461
6 SASI_Mm01_00114196 predicted 695
7 SASI_Mm01_00114197 predicted 906
8 SASI_Mm01_00114198 predicted 369
9 SASI_Mm02_00321487 predicted 521
10 SASI_Mm01_00114199 predicted 405
11 SASI_Mm01_00114200 predicted 1366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025728 predicted 1558
2 SASI_Mm01_00025729 predicted 1135
3 SASI_Mm01_00025730 predicted 1411
4 SASI_Mm01_00025731 predicted 1537
5 SASI_Mm01_00025732 predicted 1464
6 SASI_Mm01_00025733 predicted 696
7 SASI_Mm01_00025734 predicted 904
8 SASI_Mm01_00025735 predicted 363
9 SASI_Mm02_00346515 predicted 522
10 SASI_Mm01_00025736 predicted 408
11 SASI_Mm01_00025737 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105902 predicted 1500
2 SASI_Mm01_00105903 predicted 1089
3 SASI_Mm01_00105904 predicted 1352
4 SASI_Mm01_00105905 predicted 1493
5 SASI_Mm01_00105906 predicted 1407
6 SASI_Mm01_00105907 predicted 642
7 SASI_Mm01_00105908 predicted 857
8 SASI_Mm01_00105909 predicted 313
9 SASI_Mm02_00348324 predicted 475
10 SASI_Mm01_00105910 predicted 358
11 SASI_Mm01_00105911 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011805
VALIDATED
DIDO1 MISSION shRNA Bacterial Glycerol Stock
death inducer-obliterator 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-1252s1c1
Sequence:CCGGGAAGACTACATCTGCCCAAATCTCGAGATTTGGGCAGATGTAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-697s1c1
Sequence:CCGGGTATCTGACTCCTTAGGGAAACTCGAGTTTCCCTAAGGAGTCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2541s1c1
Sequence:CCGGCCCAGATTTCAAATCAGTGTTCTCGAGAACACTGATTTGAAATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2542s1c1
Sequence:CCGGCCAGATTTCAAATCAGTGTTTCTCGAGAAACACTGATTTGAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1141s1c1
Sequence:CCGGCAGCCTCACAACAACAGGTTTCTCGAGAAACCTGTTGTTGTGAGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011805.2-2392s21c1
Sequence:CCGGCATACTACACACCTACATAAACTCGAGTTTATGTAGGTGTGTAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-2158s21c1
Sequence:CCGGTTTAGGCCTTGGTAAGTATTTCTCGAGAAATACTTACCAAGGCCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1598s1c1
Sequence:CCGGGATTTCTAAGTTCAGGTAAAGCTCGAGCTTTACCTGAACTTAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011805.2-1196s21c1
Sequence:CCGGATGGTGACTGTGTGGGTATTTCTCGAGAAATACCCACACAGTCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1399s21c1
Sequence:CCGGGGAGAAGACCAGGGCATAAAGCTCGAGCTTTATGCCCTGGTCTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1891s21c1
Sequence:CCGGTCGCCCACCCTATTGAGTAAACTCGAGTTTACTCAATAGGGTGGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011805
VALIDATED
DIDO1 MISSION shRNA shRNA Plasmid DNA
death inducer-obliterator 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-1252s1c1
Sequence:CCGGGAAGACTACATCTGCCCAAATCTCGAGATTTGGGCAGATGTAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-697s1c1
Sequence:CCGGGTATCTGACTCCTTAGGGAAACTCGAGTTTCCCTAAGGAGTCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2541s1c1
Sequence:CCGGCCCAGATTTCAAATCAGTGTTCTCGAGAACACTGATTTGAAATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2542s1c1
Sequence:CCGGCCAGATTTCAAATCAGTGTTTCTCGAGAAACACTGATTTGAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1141s1c1
Sequence:CCGGCAGCCTCACAACAACAGGTTTCTCGAGAAACCTGTTGTTGTGAGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011805.2-2392s21c1
Sequence:CCGGCATACTACACACCTACATAAACTCGAGTTTATGTAGGTGTGTAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-2158s21c1
Sequence:CCGGTTTAGGCCTTGGTAAGTATTTCTCGAGAAATACTTACCAAGGCCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1598s1c1
Sequence:CCGGGATTTCTAAGTTCAGGTAAAGCTCGAGCTTTACCTGAACTTAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011805.2-1196s21c1
Sequence:CCGGATGGTGACTGTGTGGGTATTTCTCGAGAAATACCCACACAGTCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1399s21c1
Sequence:CCGGGGAGAAGACCAGGGCATAAAGCTCGAGCTTTATGCCCTGGTCTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1891s21c1
Sequence:CCGGTCGCCCACCCTATTGAGTAAACTCGAGTTTACTCAATAGGGTGGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011805
VALIDATED
DIDO1 MISSION shRNA Lentiviral Transduction Particles
death inducer-obliterator 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-1252s1c1
Sequence:CCGGGAAGACTACATCTGCCCAAATCTCGAGATTTGGGCAGATGTAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011805.2-697s1c1
Sequence:CCGGGTATCTGACTCCTTAGGGAAACTCGAGTTTCCCTAAGGAGTCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2541s1c1
Sequence:CCGGCCCAGATTTCAAATCAGTGTTCTCGAGAACACTGATTTGAAATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011805.2-2542s1c1
Sequence:CCGGCCAGATTTCAAATCAGTGTTTCTCGAGAAACACTGATTTGAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1141s1c1
Sequence:CCGGCAGCCTCACAACAACAGGTTTCTCGAGAAACCTGTTGTTGTGAGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011805.2-2392s21c1
Sequence:CCGGCATACTACACACCTACATAAACTCGAGTTTATGTAGGTGTGTAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-2158s21c1
Sequence:CCGGTTTAGGCCTTGGTAAGTATTTCTCGAGAAATACTTACCAAGGCCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011805.2-1598s1c1
Sequence:CCGGGATTTCTAAGTTCAGGTAAAGCTCGAGCTTTACCTGAACTTAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011805.2-1196s21c1
Sequence:CCGGATGGTGACTGTGTGGGTATTTCTCGAGAAATACCCACACAGTCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1399s21c1
Sequence:CCGGGGAGAAGACCAGGGCATAAAGCTCGAGCTTTATGCCCTGGTCTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011805.2-1891s21c1
Sequence:CCGGTCGCCCACCCTATTGAGTAAACTCGAGTTTACTCAATAGGGTGGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022105
VALIDATED
DIDO1 MISSION shRNA Bacterial Glycerol Stock
death inducer-obliterator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2021s1c1
Sequence:CCGGGCGAGCGATCACAATTACAATCTCGAGATTGTAATTGTGATCGCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1330s1c1
Sequence:CCGGGCCTCACAACAACAGGTTTATCTCGAGATAAACCTGTTGTTGTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2131s1c1
Sequence:CCGGCCGTTCTTTCTGGATAGCCATCTCGAGATGGCTATCCAGAAAGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1502s1c1
Sequence:CCGGGCAGATCAGCAGGAAGCTAAACTCGAGTTTAGCTTCCTGCTGATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1594s1c1
Sequence:CCGGCCAAGGGATAAAGGGTAGAATCTCGAGATTCTACCCTTTATCCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022105.3-2194s21c1
Sequence:CCGGTCTCAGGCTCTGGTAAGTATTCTCGAGAATACTTACCAGAGCCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022105.3-1893s21c1
Sequence:CCGGTCGCCGTCACTGTTGTATAAACTCGAGTTTATACAACAGTGACGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1123s21c1
Sequence:CCGGCCAACGCCCTGTATTGCATTTCTCGAGAAATGCAATACAGGGCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1691s21c1
Sequence:CCGGCGGTGCTCAGGCAGGTATTAACTCGAGTTAATACCTGCCTGAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022105
VALIDATED
DIDO1 MISSION shRNA shRNA Plasmid DNA
death inducer-obliterator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2021s1c1
Sequence:CCGGGCGAGCGATCACAATTACAATCTCGAGATTGTAATTGTGATCGCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1330s1c1
Sequence:CCGGGCCTCACAACAACAGGTTTATCTCGAGATAAACCTGTTGTTGTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2131s1c1
Sequence:CCGGCCGTTCTTTCTGGATAGCCATCTCGAGATGGCTATCCAGAAAGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1502s1c1
Sequence:CCGGGCAGATCAGCAGGAAGCTAAACTCGAGTTTAGCTTCCTGCTGATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1594s1c1
Sequence:CCGGCCAAGGGATAAAGGGTAGAATCTCGAGATTCTACCCTTTATCCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022105.3-2194s21c1
Sequence:CCGGTCTCAGGCTCTGGTAAGTATTCTCGAGAATACTTACCAGAGCCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022105.3-1893s21c1
Sequence:CCGGTCGCCGTCACTGTTGTATAAACTCGAGTTTATACAACAGTGACGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1123s21c1
Sequence:CCGGCCAACGCCCTGTATTGCATTTCTCGAGAAATGCAATACAGGGCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1691s21c1
Sequence:CCGGCGGTGCTCAGGCAGGTATTAACTCGAGTTAATACCTGCCTGAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022105
VALIDATED
DIDO1 MISSION shRNA Lentiviral Transduction Particles
death inducer-obliterator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2021s1c1
Sequence:CCGGGCGAGCGATCACAATTACAATCTCGAGATTGTAATTGTGATCGCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1330s1c1
Sequence:CCGGGCCTCACAACAACAGGTTTATCTCGAGATAAACCTGTTGTTGTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-2131s1c1
Sequence:CCGGCCGTTCTTTCTGGATAGCCATCTCGAGATGGCTATCCAGAAAGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1502s1c1
Sequence:CCGGGCAGATCAGCAGGAAGCTAAACTCGAGTTTAGCTTCCTGCTGATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022105.2-1594s1c1
Sequence:CCGGCCAAGGGATAAAGGGTAGAATCTCGAGATTCTACCCTTTATCCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022105.3-2194s21c1
Sequence:CCGGTCTCAGGCTCTGGTAAGTATTCTCGAGAATACTTACCAGAGCCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022105.3-1893s21c1
Sequence:CCGGTCGCCGTCACTGTTGTATAAACTCGAGTTTATACAACAGTGACGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1123s21c1
Sequence:CCGGCCAACGCCCTGTATTGCATTTCTCGAGAAATGCAATACAGGGCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_022105.3-1691s21c1
Sequence:CCGGCGGTGCTCAGGCAGGTATTAACTCGAGTTAATACCTGCCTGAGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)