EMAIL THIS PAGE TO A FRIEND

DIEXF

digestive organ expansion factor homolog (zebrafish)

216 Gene Product Result for
Synonyms: C1orf107 DEF DJ434O14.5 UTP25
UniProtKB ID: Q68CQ4, O75992, Q4VY00, Q63HL9
Gene ID:
Mouse(215193) digestive organ expansion factor homolog (zebrafish)
Rat(305076) digestive organ expansion factor homolog (zebrafish)
sheep(101104924) digestive organ expansion factor homolog (zebrafish)
naked mole-rat(101711120) digestive organ expansion factor homolog (zebrafish)
domestic guinea pig(100730009) digestive organ expansion factor homolog (zebrafish)
Zebrafish(286787) digestive organ expansion factor homolog
cow(510385) digestive organ expansion factor homolog (zebrafish)
domestic cat(101093911) digestive organ expansion factor homolog (zebrafish)
dog(490274) digestive organ expansion factor homolog (zebrafish)
chicken(421384) digestive organ expansion factor homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014388 Rosetta Predictions human pricing
NM_001013986 Rosetta Predictions rat pricing
NM_145415 Rosetta Predictions mouse pricing
NM_175292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345558 predicted 2410
2 SASI_Hs01_00223274 predicted 837
3 SASI_Hs02_00345559 predicted 908
4 SASI_Hs01_00223275 predicted 729
5 SASI_Hs02_00345560 predicted 825
6 SASI_Hs01_00223276 predicted 2256
7 SASI_Hs02_00345561 predicted 2290
8 SASI_Hs01_00223277 predicted 976
9 SASI_Hs01_00223279 predicted 1011
10 SASI_Hs02_00345562 predicted 944
11 SASI_Hs01_00223273 predicted 1325
12 SASI_Hs01_00223278 predicted 1495
13 SASI_Hs01_00223280 predicted 1328
14 SASI_Hs01_00223281 predicted 2364
15 SASI_Hs01_00223282 predicted 1642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118684 predicted 1673
2 SASI_Rn01_00118685 predicted 2338
3 SASI_Rn01_00118687 predicted 1081
4 SASI_Rn01_00118688 predicted 2000
5 SASI_Rn01_00118689 predicted 830
6 SASI_Rn02_00201338 predicted 1543
7 SASI_Rn01_00118690 predicted 1046
8 SASI_Rn01_00118691 predicted 947
9 SASI_Rn01_00118692 predicted 656
10 SASI_Rn01_00118693 predicted 1527
11 SASI_Rn01_00118686 predicted 1978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138640 predicted 2001
2 SASI_Mm01_00138641 predicted 1379
3 SASI_Mm01_00138642 predicted 852
4 SASI_Mm01_00138643 predicted 2183
5 SASI_Mm01_00138644 predicted 1069
6 SASI_Mm01_00138645 predicted 972
7 SASI_Mm01_00138646 predicted 1039
8 SASI_Mm01_00138647 predicted 2368
9 SASI_Mm01_00138648 predicted 1692
10 SASI_Mm02_00340759 predicted 1884
11 SASI_Mm01_00138649 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095131 predicted 2003
2 SASI_Mm01_00095132 predicted 1383
3 SASI_Mm01_00095133 predicted 852
4 SASI_Mm01_00095134 predicted 2195
5 SASI_Mm01_00095135 predicted 1072
6 SASI_Mm01_00095136 predicted 970
7 SASI_Mm01_00095137 predicted 1042
8 SASI_Mm01_00095138 predicted 2368
9 SASI_Mm01_00095139 predicted 1699
10 SASI_Mm01_00095140 predicted 1716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014388
VALIDATED
DIEXF MISSION shRNA Bacterial Glycerol Stock
digestive organ expansion factor homolog (zebrafish)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-1320s21c1
Sequence:CCGGCCGTATTTGTGGGCAATATTGCTCGAGCAATATTGCCCACAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1004s21c1
Sequence:CCGGTATTGCCTGCATGTGATAAATCTCGAGATTTATCACATGCAGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014388.5-3409s21c1
Sequence:CCGGTTACGGTTTGTTACATCATTACTCGAGTAATGATGTAACAAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-2135s21c1
Sequence:CCGGTTCTATGAACTGCCGACATATCTCGAGATATGTCGGCAGTTCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1945s21c1
Sequence:CCGGCTTCGTGCGTCTTCGAAATTACTCGAGTAATTTCGAAGACGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-7117s1c1
Sequence:CCGGCGCTGGACTTTAATGAGATAACTCGAGTTATCTCATTAAAGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-748s1c1
Sequence:CCGGCCCAAAGGATATTGACTTAAACTCGAGTTTAAGTCAATATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-673s1c1
Sequence:CCGGCCACGAGCTTAAATGGCCTATCTCGAGATAGGCCATTTAAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-67s1c1
Sequence:CCGGGCTACTCAACACCCTAACTAACTCGAGTTAGTTAGGGTGTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-1594s1c1
Sequence:CCGGCCTCAATAATTGGTCCAAGTACTCGAGTACTTGGACCAATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014388
VALIDATED
DIEXF MISSION shRNA shRNA Plasmid DNA
digestive organ expansion factor homolog (zebrafish)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-1320s21c1
Sequence:CCGGCCGTATTTGTGGGCAATATTGCTCGAGCAATATTGCCCACAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1004s21c1
Sequence:CCGGTATTGCCTGCATGTGATAAATCTCGAGATTTATCACATGCAGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014388.5-3409s21c1
Sequence:CCGGTTACGGTTTGTTACATCATTACTCGAGTAATGATGTAACAAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-2135s21c1
Sequence:CCGGTTCTATGAACTGCCGACATATCTCGAGATATGTCGGCAGTTCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1945s21c1
Sequence:CCGGCTTCGTGCGTCTTCGAAATTACTCGAGTAATTTCGAAGACGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-7117s1c1
Sequence:CCGGCGCTGGACTTTAATGAGATAACTCGAGTTATCTCATTAAAGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-748s1c1
Sequence:CCGGCCCAAAGGATATTGACTTAAACTCGAGTTTAAGTCAATATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-673s1c1
Sequence:CCGGCCACGAGCTTAAATGGCCTATCTCGAGATAGGCCATTTAAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-67s1c1
Sequence:CCGGGCTACTCAACACCCTAACTAACTCGAGTTAGTTAGGGTGTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-1594s1c1
Sequence:CCGGCCTCAATAATTGGTCCAAGTACTCGAGTACTTGGACCAATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014388
VALIDATED
DIEXF MISSION shRNA Lentiviral Transduction Particles
digestive organ expansion factor homolog (zebrafish)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-1320s21c1
Sequence:CCGGCCGTATTTGTGGGCAATATTGCTCGAGCAATATTGCCCACAAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1004s21c1
Sequence:CCGGTATTGCCTGCATGTGATAAATCTCGAGATTTATCACATGCAGGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014388.5-3409s21c1
Sequence:CCGGTTACGGTTTGTTACATCATTACTCGAGTAATGATGTAACAAACCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014388.5-2135s21c1
Sequence:CCGGTTCTATGAACTGCCGACATATCTCGAGATATGTCGGCAGTTCATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014388.5-1945s21c1
Sequence:CCGGCTTCGTGCGTCTTCGAAATTACTCGAGTAATTTCGAAGACGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-7117s1c1
Sequence:CCGGCGCTGGACTTTAATGAGATAACTCGAGTTATCTCATTAAAGTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-748s1c1
Sequence:CCGGCCCAAAGGATATTGACTTAAACTCGAGTTTAAGTCAATATCCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-673s1c1
Sequence:CCGGCCACGAGCTTAAATGGCCTATCTCGAGATAGGCCATTTAAGCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-67s1c1
Sequence:CCGGGCTACTCAACACCCTAACTAACTCGAGTTAGTTAGGGTGTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014388.4-1594s1c1
Sequence:CCGGCCTCAATAATTGGTCCAAGTACTCGAGTACTTGGACCAATTATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145415
VALIDATED
DIEXF MISSION shRNA Bacterial Glycerol Stock
digestive organ expansion factor homolog (zebrafish)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-2006s21c1
Sequence:CCGGCTTTGTGCGTCTCCGAAATTACTCGAGTAATTTCGGAGACGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1187s21c1
Sequence:CCGGCACCAGGCCTAAGGTACTTATCTCGAGATAAGTACCTTAGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145415.2-3017s21c1
Sequence:CCGGACCTAGAAGAGTACGTTTATTCTCGAGAATAAACGTACTCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145415.2-1558s21c1
Sequence:CCGGCCGTTGAGCTGCTCATCATTGCTCGAGCAATGATGAGCAGCTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1065s21c1
Sequence:CCGGTACTGCCTGCATGCCATAAACCTCGAGGTTTATGGCATGCAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145415
VALIDATED
DIEXF MISSION shRNA shRNA Plasmid DNA
digestive organ expansion factor homolog (zebrafish)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-2006s21c1
Sequence:CCGGCTTTGTGCGTCTCCGAAATTACTCGAGTAATTTCGGAGACGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1187s21c1
Sequence:CCGGCACCAGGCCTAAGGTACTTATCTCGAGATAAGTACCTTAGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145415.2-3017s21c1
Sequence:CCGGACCTAGAAGAGTACGTTTATTCTCGAGAATAAACGTACTCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145415.2-1558s21c1
Sequence:CCGGCCGTTGAGCTGCTCATCATTGCTCGAGCAATGATGAGCAGCTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1065s21c1
Sequence:CCGGTACTGCCTGCATGCCATAAACCTCGAGGTTTATGGCATGCAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145415
VALIDATED
DIEXF MISSION shRNA Lentiviral Transduction Particles
digestive organ expansion factor homolog (zebrafish)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-2006s21c1
Sequence:CCGGCTTTGTGCGTCTCCGAAATTACTCGAGTAATTTCGGAGACGCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1187s21c1
Sequence:CCGGCACCAGGCCTAAGGTACTTATCTCGAGATAAGTACCTTAGGCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145415.2-3017s21c1
Sequence:CCGGACCTAGAAGAGTACGTTTATTCTCGAGAATAAACGTACTCTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145415.2-1558s21c1
Sequence:CCGGCCGTTGAGCTGCTCATCATTGCTCGAGCAATGATGAGCAGCTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145415.2-1065s21c1
Sequence:CCGGTACTGCCTGCATGCCATAAACCTCGAGGTTTATGGCATGCAGGCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks