EMAIL THIS PAGE TO A FRIEND

DIMT1

DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)

50 Gene Product Result for
Synonyms: DIM1 DIMT1L HSA9761 HUSSY5
UniProtKB ID: Q9UNQ2, O76025, Q9BU77, Q9UES1
Gene ID:
Mouse(66254) DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
Rat(294718) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
chicken(427157) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
cow(509725) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
domestic cat(101100359) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
dog(100688153) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
domestic guinea pig(100719743) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
naked mole-rat(101721788) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
sheep(101107044) DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014473 Rosetta Predictions human pricing
NM_001106408 Rosetta Predictions rat pricing
NM_025447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155129 predicted 741
2 SASI_Hs01_00155131 predicted 626
3 SASI_Hs01_00155132 predicted 291
4 SASI_Hs01_00155133 predicted 635
5 SASI_Hs01_00155134 predicted 505
6 SASI_Hs01_00155135 predicted 681
7 SASI_Hs01_00155136 predicted 322
8 SASI_Hs01_00155137 predicted 799
9 SASI_Hs02_00345708 predicted 502
10 SASI_Hs01_00155138 predicted 476
11 SASI_Hs01_00155130 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218668 predicted 1095
2 SASI_Rn02_00218669 predicted 558
3 SASI_Rn02_00218670 predicted 480
4 SASI_Rn02_00218671 predicted 444
5 SASI_Rn02_00218672 predicted 828
6 SASI_Rn02_00218673 predicted 773
7 SASI_Rn02_00218674 predicted 655
8 SASI_Rn02_00218675 predicted 463
9 SASI_Rn02_00218676 predicted 1085
10 SASI_Rn02_00218677 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039981 predicted 264
2 SASI_Mm01_00039982 predicted 803
3 SASI_Mm01_00039983 predicted 526
4 SASI_Mm01_00039984 predicted 498
5 SASI_Mm01_00039985 predicted 895
6 SASI_Mm01_00039986 predicted 755
7 SASI_Mm01_00039987 predicted 792
8 SASI_Mm01_00039988 predicted 868
9 SASI_Mm01_00039989 predicted 1470
10 SASI_Mm01_00039990 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025447
VALIDATED
DIMT1 MISSION shRNA Bacterial Glycerol Stock
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-648s1c1
Sequence:CCGGCGTGGTCAGGATAGAACCTAACTCGAGTTAGGTTCTATCCTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-490s1c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-705s1c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-187s1c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-769s1c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-230s21c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-812s21c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-748s21c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-533s21c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025447
VALIDATED
DIMT1 MISSION shRNA shRNA Plasmid DNA
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-648s1c1
Sequence:CCGGCGTGGTCAGGATAGAACCTAACTCGAGTTAGGTTCTATCCTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-490s1c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-705s1c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-187s1c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-769s1c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-230s21c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-812s21c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-748s21c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-533s21c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025447
VALIDATED
DIMT1 MISSION shRNA Lentiviral Transduction Particles
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-648s1c1
Sequence:CCGGCGTGGTCAGGATAGAACCTAACTCGAGTTAGGTTCTATCCTGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-490s1c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-705s1c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-187s1c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025447.1-769s1c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-230s21c1
Sequence:CCGGGCTGCTTTAAGACCTACCGATCTCGAGATCGGTAGGTCTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-812s21c1
Sequence:CCGGGCAGTACAACAACTGTTGGAACTCGAGTTCCAACAGTTGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-748s21c1
Sequence:CCGGCGGCTTAGTAAGGATCACTTTCTCGAGAAAGTGATCCTTACTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025447.4-533s21c1
Sequence:CCGGCTTATGTTTCAGAGAGAGTTTCTCGAGAAACTCTCTCTGAAACATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014473
VALIDATED
DIMT1 MISSION shRNA Bacterial Glycerol Stock
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014473.1-1222s1c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014473.1-202s1c1
Sequence:CCGGCCTCTCATTATTAACAGCATTCTCGAGAATGCTGTTAATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-628s1c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-340s1c1
Sequence:CCGGCCAAGGCTAGTAGCTGAACTTCTCGAGAAGTTCAGCTACTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-898s21c1
Sequence:CCGGATTCACTGTTCAGTCCATAATCTCGAGATTATGGACTGAACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-549s21c1
Sequence:CCGGGCTGTTGCTACATCGACCTTTCTCGAGAAAGGTCGATGTAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-679s21c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-1273s21c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014473.2-495s21c1
Sequence:CCGGTGATACTTGTGTGGCAAATTTCTCGAGAAATTTGCCACACAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014473
VALIDATED
DIMT1 MISSION shRNA shRNA Plasmid DNA
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014473.1-1222s1c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014473.1-202s1c1
Sequence:CCGGCCTCTCATTATTAACAGCATTCTCGAGAATGCTGTTAATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-628s1c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-340s1c1
Sequence:CCGGCCAAGGCTAGTAGCTGAACTTCTCGAGAAGTTCAGCTACTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-898s21c1
Sequence:CCGGATTCACTGTTCAGTCCATAATCTCGAGATTATGGACTGAACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-549s21c1
Sequence:CCGGGCTGTTGCTACATCGACCTTTCTCGAGAAAGGTCGATGTAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-679s21c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-1273s21c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014473.2-495s21c1
Sequence:CCGGTGATACTTGTGTGGCAAATTTCTCGAGAAATTTGCCACACAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014473
VALIDATED
DIMT1 MISSION shRNA Lentiviral Transduction Particles
DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014473.1-1222s1c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014473.1-202s1c1
Sequence:CCGGCCTCTCATTATTAACAGCATTCTCGAGAATGCTGTTAATAATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-628s1c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014473.1-340s1c1
Sequence:CCGGCCAAGGCTAGTAGCTGAACTTCTCGAGAAGTTCAGCTACTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-898s21c1
Sequence:CCGGATTCACTGTTCAGTCCATAATCTCGAGATTATGGACTGAACAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-549s21c1
Sequence:CCGGGCTGTTGCTACATCGACCTTTCTCGAGAAAGGTCGATGTAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-679s21c1
Sequence:CCGGCGTGTGGACCATCTAATGAAACTCGAGTTTCATTAGATGGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014473.2-1273s21c1
Sequence:CCGGGCTGGTCCAATCTATTCATAACTCGAGTTATGAATAGATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014473.2-495s21c1
Sequence:CCGGTGATACTTGTGTGGCAAATTTCTCGAGAAATTTGCCACACAAGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks