EMAIL THIS PAGE TO A FRIEND

DIO1

deiodinase, iodothyronine, type I

83 Gene Product Result for
Synonyms: 5DI TXDI1
Gene ID:
Human(1733) Summary: The protein encoded by this gene is a thiol-requiring propylthiouracil-sensitive oxidoreductase. It activates thyroid hormone by converting the prohormone thyroxine (T4) by outer ring deiodination (ORD) to bioactive 3,3',5-triiodothyronine (T3). It also degrades both hormones by inner ring deiodination (IRD). Alternative splicing results in multiple transcript variants encoding different isoforms. Some, but not all, isoforms contain a selenocysteine (Sec) residue encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Additional transcript variants have been described but are not supported by experimental evidence. [provided by RefSeq, Jul 2008]
Mouse(13370) deiodinase, iodothyronine, type I
Rat(25430) deiodinase, iodothyronine, type I
Zebrafish(799937) deiodinase, iodothyronine, type I
chicken(395940) deiodinase, iodothyronine, type I
domestic cat(493798) deiodinase, iodothyronine, type I
cow(782446) deiodinase, iodothyronine, type I
Horse(100050359) deiodinase, iodothyronine, type I
dog(403635) deiodinase, iodothyronine, type I
sheep(100310792) deiodinase, iodothyronine, type I
Domestic Rabbit(100101570) deiodinase, iodothyronine, type I
naked mole-rat(101704592) deiodinase, iodothyronine, type I
domestic guinea pig(100715950) deiodinase, iodothyronine, type I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000792 Rosetta Predictions human pricing
NM_001039715 Rosetta Predictions human pricing
NM_001039716 Rosetta Predictions human pricing
NM_213593 Rosetta Predictions human pricing
NM_021653 Rosetta Predictions rat pricing
NM_007860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209109 predicted 1212
2 SASI_Hs01_00209110 predicted 1263
3 SASI_Hs01_00209112 predicted 1172
4 SASI_Hs02_00303237 predicted 950
5 SASI_Hs01_00209113 predicted 1130
6 SASI_Hs01_00209114 predicted 1203
7 SASI_Hs01_00209115 predicted 1265
8 SASI_Hs01_00209116 predicted 1208
9 SASI_Hs01_00209117 predicted 1143
10 SASI_Hs01_00209118 predicted 1146
11 SASI_Hs01_00209111 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046478 predicted 1066
2 SASI_Hs01_00046479 predicted 1118
3 SASI_Hs01_00046481 predicted 1027
4 SASI_Hs02_00308654 predicted 802
5 SASI_Hs01_00046482 predicted 983
6 SASI_Hs01_00046483 predicted 1060
7 SASI_Hs01_00046484 predicted 1120
8 SASI_Hs01_00046485 predicted 1064
9 SASI_Hs01_00046486 predicted 999
10 SASI_Hs01_00046487 predicted 999
11 SASI_Hs01_00046480 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308655 predicted 821
2 SASI_Hs01_00194993 predicted 971
3 SASI_Hs01_00194995 predicted 977
4 SASI_Hs01_00194996 predicted 754
5 SASI_Hs01_00194997 predicted 925
6 SASI_Hs01_00194998 predicted 1002
7 SASI_Hs01_00194999 predicted 901
8 SASI_Hs01_00195000 predicted 945
9 SASI_Hs01_00195001 predicted 944
10 SASI_Hs01_00195002 predicted 869
11 SASI_Hs01_00194994 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066087 predicted 1022
2 SASI_Hs01_00066088 predicted 1073
3 SASI_Hs01_00066090 predicted 981
4 SASI_Hs02_00374266 predicted 762
5 SASI_Hs01_00066091 predicted 940
6 SASI_Hs01_00066092 predicted 1014
7 SASI_Hs01_00066093 predicted 1078
8 SASI_Hs01_00066094 predicted 1025
9 SASI_Hs01_00066095 predicted 958
10 SASI_Hs01_00066096 predicted 954
11 SASI_Hs01_00066089 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118856 predicted 1094
2 SASI_Rn01_00118857 predicted 1234
3 SASI_Rn01_00118858 predicted 852
4 SASI_Rn01_00118859 predicted 1185
5 SASI_Rn02_00262644 predicted 1137
6 SASI_Rn01_00118860 predicted 1134
7 SASI_Rn01_00118861 predicted 689
8 SASI_Rn01_00118862 predicted 1240
9 SASI_Rn01_00118863 predicted 1114
10 SASI_Rn01_00118864 predicted 825
11 SASI_Rn01_00118865 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107701 predicted 944
2 SASI_Mm01_00107702 predicted 876
3 SASI_Mm01_00107703 predicted 337
4 SASI_Mm01_00107704 predicted 969
5 SASI_Mm02_00312634 predicted 722
6 SASI_Mm02_00312635 predicted 939
7 SASI_Mm02_00312636 predicted 706
8 SASI_Mm01_00107706 predicted 1088
9 SASI_Mm01_00107709 predicted 371
10 SASI_Mm01_00107710 predicted 819
11 SASI_Mm01_00107705 predicted 713
12 SASI_Mm01_00107707 predicted 338
13 SASI_Mm01_00107708 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007860
DIO1 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007860.2-1263s1c1
Sequence:CCGGGCCGAAAGATTGAAATCTGTTCTCGAGAACAGATTTCAATCTTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-466s1c1
Sequence:CCGGCGATTTCCTCATCATTTACATCTCGAGATGTAAATGATGAGGAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-337s1c1
Sequence:CCGGGTGCAACATCTGGGATTTCATCTCGAGATGAAATCCCAGATGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-722s1c1
Sequence:CCGGTGGAACTACAATCCTGAGGAACTCGAGTTCCTCAGGATTGTAGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-425s1c1
Sequence:CCGGGACCAGTTCAAGAGACTCGTACTCGAGTACGAGTCTCTTGAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007860
DIO1 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007860.2-1263s1c1
Sequence:CCGGGCCGAAAGATTGAAATCTGTTCTCGAGAACAGATTTCAATCTTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-466s1c1
Sequence:CCGGCGATTTCCTCATCATTTACATCTCGAGATGTAAATGATGAGGAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-337s1c1
Sequence:CCGGGTGCAACATCTGGGATTTCATCTCGAGATGAAATCCCAGATGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-722s1c1
Sequence:CCGGTGGAACTACAATCCTGAGGAACTCGAGTTCCTCAGGATTGTAGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-425s1c1
Sequence:CCGGGACCAGTTCAAGAGACTCGTACTCGAGTACGAGTCTCTTGAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007860
DIO1 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007860.2-1263s1c1
Sequence:CCGGGCCGAAAGATTGAAATCTGTTCTCGAGAACAGATTTCAATCTTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-466s1c1
Sequence:CCGGCGATTTCCTCATCATTTACATCTCGAGATGTAAATGATGAGGAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-337s1c1
Sequence:CCGGGTGCAACATCTGGGATTTCATCTCGAGATGAAATCCCAGATGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-722s1c1
Sequence:CCGGTGGAACTACAATCCTGAGGAACTCGAGTTCCTCAGGATTGTAGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007860.2-425s1c1
Sequence:CCGGGACCAGTTCAAGAGACTCGTACTCGAGTACGAGTCTCTTGAACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000792
DIO1 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type I
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-721s1c1
Sequence:CCGGGAAGTTCGTGCTGTTCTGGAACTCGAGTTCCAGAACAGCACGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-90s1c1
Sequence:CCGGGCTTCTGATATTGTTTCCAGACTCGAGTCTGGAAACAATATCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-504s1c1
Sequence:CCGGGAACAACATGGACATCAGAAACTCGAGTTTCTGATGTCCATGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-414s1c1
Sequence:CCGGCAAGAGGCTTATTGAAGACTTCTCGAGAAGTCTTCAATAAGCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-430s1c1
Sequence:CCGGGACTTTAGTTCCATAGCAGATCTCGAGATCTGCTATGGAACTAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-469s1c1
Sequence:CCGGGAAGAAGCACATGCATCAGATCTCGAGATCTGATGCATGTGCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-181s1c1
Sequence:CCGGGACAACTGGATACCAACCTTTCTCGAGAAAGGTTGGTATCCAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-210s1c1
Sequence:CCGGCCAGTATTTCTGGTTCGTCTTCTCGAGAAGACGAACCAGAAATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-180s1c1
Sequence:CCGGCGACAACTGGATACCAACCTTCTCGAGAAGGTTGGTATCCAGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-642s1c1
Sequence:CCGGGCCTGAGAGGCTCTACATAATCTCGAGATTATGTAGAGCCTCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-648s1c1
Sequence:CCGGGAGGCTCTACATAATCCAGGACTCGAGTCCTGGATTATGTAGAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-209s1c1
Sequence:CCGGCCCAGTATTTCTGGTTCGTCTCTCGAGAGACGAACCAGAAATACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000792
DIO1 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type I
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-721s1c1
Sequence:CCGGGAAGTTCGTGCTGTTCTGGAACTCGAGTTCCAGAACAGCACGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-90s1c1
Sequence:CCGGGCTTCTGATATTGTTTCCAGACTCGAGTCTGGAAACAATATCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-504s1c1
Sequence:CCGGGAACAACATGGACATCAGAAACTCGAGTTTCTGATGTCCATGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-414s1c1
Sequence:CCGGCAAGAGGCTTATTGAAGACTTCTCGAGAAGTCTTCAATAAGCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-430s1c1
Sequence:CCGGGACTTTAGTTCCATAGCAGATCTCGAGATCTGCTATGGAACTAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-469s1c1
Sequence:CCGGGAAGAAGCACATGCATCAGATCTCGAGATCTGATGCATGTGCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-181s1c1
Sequence:CCGGGACAACTGGATACCAACCTTTCTCGAGAAAGGTTGGTATCCAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-210s1c1
Sequence:CCGGCCAGTATTTCTGGTTCGTCTTCTCGAGAAGACGAACCAGAAATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-180s1c1
Sequence:CCGGCGACAACTGGATACCAACCTTCTCGAGAAGGTTGGTATCCAGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-642s1c1
Sequence:CCGGGCCTGAGAGGCTCTACATAATCTCGAGATTATGTAGAGCCTCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-648s1c1
Sequence:CCGGGAGGCTCTACATAATCCAGGACTCGAGTCCTGGATTATGTAGAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-209s1c1
Sequence:CCGGCCCAGTATTTCTGGTTCGTCTCTCGAGAGACGAACCAGAAATACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000792
DIO1 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type I
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-721s1c1
Sequence:CCGGGAAGTTCGTGCTGTTCTGGAACTCGAGTTCCAGAACAGCACGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-90s1c1
Sequence:CCGGGCTTCTGATATTGTTTCCAGACTCGAGTCTGGAAACAATATCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-504s1c1
Sequence:CCGGGAACAACATGGACATCAGAAACTCGAGTTTCTGATGTCCATGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-414s1c1
Sequence:CCGGCAAGAGGCTTATTGAAGACTTCTCGAGAAGTCTTCAATAAGCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-430s1c1
Sequence:CCGGGACTTTAGTTCCATAGCAGATCTCGAGATCTGCTATGGAACTAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-469s1c1
Sequence:CCGGGAAGAAGCACATGCATCAGATCTCGAGATCTGATGCATGTGCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-181s1c1
Sequence:CCGGGACAACTGGATACCAACCTTTCTCGAGAAAGGTTGGTATCCAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-210s1c1
Sequence:CCGGCCAGTATTTCTGGTTCGTCTTCTCGAGAAGACGAACCAGAAATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-180s1c1
Sequence:CCGGCGACAACTGGATACCAACCTTCTCGAGAAGGTTGGTATCCAGTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-642s1c1
Sequence:CCGGGCCTGAGAGGCTCTACATAATCTCGAGATTATGTAGAGCCTCTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155007    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000792.2-648s1c1
Sequence:CCGGGAGGCTCTACATAATCCAGGACTCGAGTCCTGGATTATGTAGAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000792.2-209s1c1
Sequence:CCGGCCCAGTATTTCTGGTTCGTCTCTCGAGAGACGAACCAGAAATACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)