EMAIL THIS PAGE TO A FRIEND

DIO2

deiodinase, iodothyronine, type II

252 Gene Product Result for
Synonyms: 5DII D2 DIOII SelY TXDI2
Gene ID:
Human(1734) Summary: The protein encoded by this gene belongs to the iodothyronine deiodinase family. It activates thyroid hormone by converting the prohormone thyroxine (T4) by outer ring deiodination (ORD) to bioactive 3,3',5-triiodothyronine (T3). It is highly expressed in the thyroid, and may contribute significantly to the relative increase in thyroidal T3 production in patients with Graves disease and thyroid adenomas. This protein contains selenocysteine (Sec) residues encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(13371) deiodinase, iodothyronine, type II
Rat(65162) deiodinase, iodothyronine, type II
domestic guinea pig(100721073) deiodinase, iodothyronine, type II
naked mole-rat(101697296) deiodinase, iodothyronine, type II
Goat(100861220) deiodinase, iodothyronine, type II
Domestic Rabbit(100354221) deiodinase, iodothyronine, type II
sheep(100310793) deiodinase, iodothyronine, type II
Zebrafish(352937) deiodinase, iodothyronine, type II
chicken(373903) deiodinase, iodothyronine, type II
domestic cat(101088170) deiodinase, iodothyronine, type II
cow(494548) deiodinase, iodothyronine, type II
Horse(100052547) deiodinase, iodothyronine, type II
dog(490813) deiodinase, iodothyronine, type II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000793 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231181 MISSION® esiRNA esiRNA targeting human DIO2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000793 Rosetta Predictions human pricing
NM_001007023 Rosetta Predictions human pricing
NM_013989 Rosetta Predictions human pricing
NM_031720 Rosetta Predictions rat pricing
NM_010050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175564 predicted 1473
2 SASI_Hs01_00175565 predicted 1503
3 SASI_Hs02_00303238 predicted 823
4 SASI_Hs01_00175566 predicted 1305
5 SASI_Hs01_00175568 predicted 1359
6 SASI_Hs01_00175569 predicted 1356
7 SASI_Hs01_00175570 predicted 1336
8 SASI_Hs01_00175571 predicted 1222
9 SASI_Hs01_00175572 predicted 1313
10 SASI_Hs02_00303239 predicted 855
11 SASI_Hs01_00175567 predicted 1287
12 SASI_Hs01_00175573 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090766 predicted 1212
2 SASI_Hs01_00090767 predicted 1232
3 SASI_Hs02_00305175 predicted 557
4 SASI_Hs01_00090768 predicted 1035
5 SASI_Hs01_00090770 predicted 1093
6 SASI_Hs01_00090771 predicted 1086
7 SASI_Hs01_00090772 predicted 1073
8 SASI_Hs01_00090773 predicted 959
9 SASI_Hs01_00090774 predicted 1045
10 SASI_Hs02_00305176 predicted 591
11 SASI_Hs01_00090769 predicted 1013
12 SASI_Hs01_00090775 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029989 predicted 1780
2 SASI_Hs01_00029990 predicted 1811
3 SASI_Hs02_00344952 predicted 1138
4 SASI_Hs01_00029991 predicted 1614
5 SASI_Hs01_00029993 predicted 1672
6 SASI_Hs01_00029994 predicted 1666
7 SASI_Hs01_00029995 predicted 1646
8 SASI_Hs01_00029996 predicted 1532
9 SASI_Hs01_00029997 predicted 1623
10 SASI_Hs02_00344953 predicted 1165
11 SASI_Hs01_00029992 predicted 1591
12 SASI_Hs01_00029998 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071443 predicted 880
2 SASI_Rn01_00071438 predicted 1507
3 SASI_Rn01_00071440 predicted 1379
4 SASI_Rn01_00071441 predicted 1366
5 SASI_Rn01_00071442 predicted 1485
6 SASI_Rn02_00265088 predicted 721
7 SASI_Rn02_00265089 predicted 1556
8 SASI_Rn01_00071445 predicted 1331
9 SASI_Rn02_00265090 predicted 798
10 SASI_Rn02_00265091 predicted 1193
11 SASI_Rn01_00071439 predicted 1002
12 SASI_Rn01_00071444 predicted 953
13 SASI_Rn01_00071446 predicted 1101
14 SASI_Rn01_00071447 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026857 predicted 963
2 SASI_Mm01_00026858 predicted 954
3 SASI_Mm01_00026859 predicted 954
4 SASI_Mm01_00026861 predicted 231
5 SASI_Mm01_00026862 predicted 963
6 SASI_Mm01_00026863 predicted 950
7 SASI_Mm01_00026864 predicted 357
8 SASI_Mm01_00026865 predicted 915
9 SASI_Mm02_00317692 predicted 884
10 SASI_Mm01_00026866 predicted 1015
11 SASI_Mm01_00026860 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010050
DIO2 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-784s1c1
Sequence:CCGGCCGCATGGACAATAATGCCAACTCGAGTTGGCATTATTGTCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-230s1c1
Sequence:CCGGGCGCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010050.1-4633s1c1
Sequence:CCGGGCCTTAAATGTAGAAGCCAAACTCGAGTTTGGCTTCTACATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-374s1c1
Sequence:CCGGCAGGTTAAACTGGGTGAAGATCTCGAGATCTTCACCCAGTTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-894s1c1
Sequence:CCGGACCTACAAGAAGTCCGAAGTTCTCGAGAACTTCGGACTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010050
DIO2 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-784s1c1
Sequence:CCGGCCGCATGGACAATAATGCCAACTCGAGTTGGCATTATTGTCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-230s1c1
Sequence:CCGGGCGCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010050.1-4633s1c1
Sequence:CCGGGCCTTAAATGTAGAAGCCAAACTCGAGTTTGGCTTCTACATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-374s1c1
Sequence:CCGGCAGGTTAAACTGGGTGAAGATCTCGAGATCTTCACCCAGTTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-894s1c1
Sequence:CCGGACCTACAAGAAGTCCGAAGTTCTCGAGAACTTCGGACTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010050
DIO2 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-784s1c1
Sequence:CCGGCCGCATGGACAATAATGCCAACTCGAGTTGGCATTATTGTCCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-230s1c1
Sequence:CCGGGCGCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010050.1-4633s1c1
Sequence:CCGGGCCTTAAATGTAGAAGCCAAACTCGAGTTTGGCTTCTACATTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-374s1c1
Sequence:CCGGCAGGTTAAACTGGGTGAAGATCTCGAGATCTTCACCCAGTTTAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010050.1-894s1c1
Sequence:CCGGACCTACAAGAAGTCCGAAGTTCTCGAGAACTTCGGACTTCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000793
VALIDATED
DIO2 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-940s1c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000793.2-620s1c1
Sequence:CCGGCAGGTGAAATTGGGTGAGGATCTCGAGATCCTCACCCAATTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1076s1c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1136s1c1
Sequence:CCGGCCCTTCTCCTACAACCTTCAACTCGAGTTGAAGGTTGTAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-476s1c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1216s21c1
Sequence:CCGGGCTGGTTAAAGGTATGATTATCTCGAGATAATCATACCTTTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1078s21c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000793.4-1614s21c1
Sequence:CCGGGTATTGCCTTGGCTCTATTTGCTCGAGCAAATAGAGCCAAGGCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-478s21c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-942s21c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000793
VALIDATED
DIO2 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-940s1c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000793.2-620s1c1
Sequence:CCGGCAGGTGAAATTGGGTGAGGATCTCGAGATCCTCACCCAATTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1076s1c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1136s1c1
Sequence:CCGGCCCTTCTCCTACAACCTTCAACTCGAGTTGAAGGTTGTAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-476s1c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1216s21c1
Sequence:CCGGGCTGGTTAAAGGTATGATTATCTCGAGATAATCATACCTTTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1078s21c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000793.4-1614s21c1
Sequence:CCGGGTATTGCCTTGGCTCTATTTGCTCGAGCAAATAGAGCCAAGGCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-478s21c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-942s21c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000793
VALIDATED
DIO2 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-940s1c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000793.2-620s1c1
Sequence:CCGGCAGGTGAAATTGGGTGAGGATCTCGAGATCCTCACCCAATTTCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1076s1c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-1136s1c1
Sequence:CCGGCCCTTCTCCTACAACCTTCAACTCGAGTTGAAGGTTGTAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000793.2-476s1c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1216s21c1
Sequence:CCGGGCTGGTTAAAGGTATGATTATCTCGAGATAATCATACCTTTAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-1078s21c1
Sequence:CCGGGCCTTTGAACGTGTGTGCATTCTCGAGAATGCACACACGTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000793.4-1614s21c1
Sequence:CCGGGTATTGCCTTGGCTCTATTTGCTCGAGCAAATAGAGCCAAGGCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-478s21c1
Sequence:CCGGGCTCTCTATGACTCGGTCATTCTCGAGAATGACCGAGTCATAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000793.4-942s21c1
Sequence:CCGGTGAGGTGAAGAAGCACCAGAACTCGAGTTCTGGTGCTTCTTCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks