EMAIL THIS PAGE TO A FRIEND

DIO3

deiodinase, iodothyronine, type III

90 Gene Product Result for
Synonyms: 5DIII D3 DIOIII TXDI3
UniProtKB ID: P55073, Q8WVN5
Gene ID:
Human(1735) Summary: The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3',5-triiodothyronine (T3) to inactive metabolites, 3,3',5'-triiodothyronine (RT3) and 3,3'-diiodothyronine (T2), respectively. This enzyme is highly expressed in the pregnant uterus, placenta, fetal and neonatal tissues, suggesting that it plays an essential role in the regulation of thyroid hormone inactivation during embryological development. This protein contains a selenocysteine (Sec) residue, which is essential for efficient enzyme activity. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
Mouse(107585) deiodinase, iodothyronine type III
Rat(29475) deiodinase, iodothyronine, type III
chicken(395939) deiodinase, iodothyronine, type III
cow(494549) deiodinase, iodothyronine, type III
Horse(100146344) deiodinase, iodothyronine, type III
domestic cat(101094186) deiodinase, iodothyronine, type III
dog(612596) deiodinase, iodothyronine, type III
sheep(100142657) deiodinase, iodothyronine, type III
Domestic Rabbit(100357267) deiodinase, iodothyronine, type III
naked mole-rat(101697914) deiodinase, iodothyronine, type III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301592 ANTI-DIO3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001362 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001362 Rosetta Predictions human pricing
NM_017210 Rosetta Predictions rat pricing
NM_172119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331705 predicted 1167
2 SASI_Hs01_00227926 predicted 1061
3 SASI_Hs01_00227927 predicted 1298
4 SASI_Hs01_00227928 predicted 992
5 SASI_Hs02_00331706 predicted 1000
6 SASI_Hs02_00331707 predicted 1164
7 SASI_Hs01_00227929 predicted 1046
8 SASI_Hs01_00227930 predicted 1115
9 SASI_Hs01_00227932 predicted 824
10 SASI_Hs02_00331708 predicted 1481
11 SASI_Hs01_00227924 predicted 930
12 SASI_Hs01_00227925 predicted 786
13 SASI_Hs01_00227931 predicted 441
14 SASI_Hs01_00227933 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043957 predicted 605
2 SASI_Rn01_00043958 predicted 998
3 SASI_Rn01_00043959 predicted 1034
4 SASI_Rn01_00043960 predicted 822
5 SASI_Rn01_00043961 predicted 928
6 SASI_Rn01_00043962 predicted 1174
7 SASI_Rn01_00043963 predicted 708
8 SASI_Rn01_00043964 predicted 210
9 SASI_Rn02_00261570 predicted 1110
10 SASI_Rn02_00261571 predicted 805
11 SASI_Rn01_00043965 predicted 1328
12 SASI_Rn01_00043966 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081361 predicted 1036
2 SASI_Mm01_00081363 predicted 896
3 SASI_Mm01_00081364 predicted 736
4 SASI_Mm01_00081365 predicted 1115
5 SASI_Mm01_00081366 predicted 885
6 SASI_Mm01_00081367 predicted 299
7 SASI_Mm01_00081368 predicted 871
8 SASI_Mm01_00081369 predicted 956
9 SASI_Mm02_00343657 predicted 934
10 SASI_Mm02_00343658 predicted 877
11 SASI_Mm01_00081360 predicted 1155
12 SASI_Mm01_00081362 predicted 1072
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172119
DIO3 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type III
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172119.2-301s21c1
Sequence:CCGGTATGCGTATCAGACGACAACCCTCGAGGGTTGTCGTCTGATACGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1122s21c1
Sequence:CCGGAGCATTGCTGTGGCTCGAACTCTCGAGAGTTCGAGCCACAGCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1064s21c1
Sequence:CCGGCTAACTTGAGACTCTGCTATACTCGAGTATAGCAGAGTCTCAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-870s1c1
Sequence:CCGGCGCTATGATGAACAGTTGCATCTCGAGATGCAACTGTTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-359s1c1
Sequence:CCGGCCAGAAATTGGATTTCTTCAACTCGAGTTGAAGAAATCCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-681s1c1
Sequence:CCGGGCAGCGAGAGTACTACAACAACTCGAGTTGTTGTAGTACTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-566s1c1
Sequence:CCGGCGACGTTGACTTCCTTATCATCTCGAGATGATAAGGAAGTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172119
DIO3 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type III
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172119.2-301s21c1
Sequence:CCGGTATGCGTATCAGACGACAACCCTCGAGGGTTGTCGTCTGATACGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1122s21c1
Sequence:CCGGAGCATTGCTGTGGCTCGAACTCTCGAGAGTTCGAGCCACAGCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1064s21c1
Sequence:CCGGCTAACTTGAGACTCTGCTATACTCGAGTATAGCAGAGTCTCAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-870s1c1
Sequence:CCGGCGCTATGATGAACAGTTGCATCTCGAGATGCAACTGTTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-359s1c1
Sequence:CCGGCCAGAAATTGGATTTCTTCAACTCGAGTTGAAGAAATCCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-681s1c1
Sequence:CCGGGCAGCGAGAGTACTACAACAACTCGAGTTGTTGTAGTACTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-566s1c1
Sequence:CCGGCGACGTTGACTTCCTTATCATCTCGAGATGATAAGGAAGTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172119
DIO3 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type III
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172119.2-301s21c1
Sequence:CCGGTATGCGTATCAGACGACAACCCTCGAGGGTTGTCGTCTGATACGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1122s21c1
Sequence:CCGGAGCATTGCTGTGGCTCGAACTCTCGAGAGTTCGAGCCACAGCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172119.2-1064s21c1
Sequence:CCGGCTAACTTGAGACTCTGCTATACTCGAGTATAGCAGAGTCTCAAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-870s1c1
Sequence:CCGGCGCTATGATGAACAGTTGCATCTCGAGATGCAACTGTTCATCATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-359s1c1
Sequence:CCGGCCAGAAATTGGATTTCTTCAACTCGAGTTGAAGAAATCCAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-681s1c1
Sequence:CCGGGCAGCGAGAGTACTACAACAACTCGAGTTGTTGTAGTACTCTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172119.1-566s1c1
Sequence:CCGGCGACGTTGACTTCCTTATCATCTCGAGATGATAAGGAAGTCAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001362
DIO3 MISSION shRNA Bacterial Glycerol Stock
deiodinase, iodothyronine, type III
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-389s1c1
Sequence:CCGGGAAGTGGAGCTCAACAGTGAACTCGAGTTCACTGTTGAGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-715s1c1
Sequence:CCGGCGACTTCCTCATCATCTACATCTCGAGATGTAGATGATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-328s1c1
Sequence:CCGGCGATTTCTTGTGTATCCGCAACTCGAGTTGCGGATACACAAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-334s1c1
Sequence:CCGGCTTGTGTATCCGCAAGCATTTCTCGAGAAATGCTTGCGGATACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-501s1c1
Sequence:CCGGGCCAGAAGTTGGATTTCTTCACTCGAGTGAAGAAATCCAACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-937s1c1
Sequence:CCGGGAGTGGCACTATTATGTACCACTCGAGTGGTACATAATAGTGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-722s1c1
Sequence:CCGGCTCATCATCTACATCGAGGAACTCGAGTTCCTCGATGTAGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-322s1c1
Sequence:CCGGGCTTCTCGATTTCTTGTGTATCTCGAGATACACAAGAAATCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-502s1c1
Sequence:CCGGCCAGAAGTTGGATTTCTTCAACTCGAGTTGAAGAAATCCAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001362
DIO3 MISSION shRNA shRNA Plasmid DNA
deiodinase, iodothyronine, type III
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-389s1c1
Sequence:CCGGGAAGTGGAGCTCAACAGTGAACTCGAGTTCACTGTTGAGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-715s1c1
Sequence:CCGGCGACTTCCTCATCATCTACATCTCGAGATGTAGATGATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-328s1c1
Sequence:CCGGCGATTTCTTGTGTATCCGCAACTCGAGTTGCGGATACACAAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-334s1c1
Sequence:CCGGCTTGTGTATCCGCAAGCATTTCTCGAGAAATGCTTGCGGATACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-501s1c1
Sequence:CCGGGCCAGAAGTTGGATTTCTTCACTCGAGTGAAGAAATCCAACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-937s1c1
Sequence:CCGGGAGTGGCACTATTATGTACCACTCGAGTGGTACATAATAGTGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-722s1c1
Sequence:CCGGCTCATCATCTACATCGAGGAACTCGAGTTCCTCGATGTAGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-322s1c1
Sequence:CCGGGCTTCTCGATTTCTTGTGTATCTCGAGATACACAAGAAATCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-502s1c1
Sequence:CCGGCCAGAAGTTGGATTTCTTCAACTCGAGTTGAAGAAATCCAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001362
DIO3 MISSION shRNA Lentiviral Transduction Particles
deiodinase, iodothyronine, type III
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-389s1c1
Sequence:CCGGGAAGTGGAGCTCAACAGTGAACTCGAGTTCACTGTTGAGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-715s1c1
Sequence:CCGGCGACTTCCTCATCATCTACATCTCGAGATGTAGATGATGAGGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-328s1c1
Sequence:CCGGCGATTTCTTGTGTATCCGCAACTCGAGTTGCGGATACACAAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-334s1c1
Sequence:CCGGCTTGTGTATCCGCAAGCATTTCTCGAGAAATGCTTGCGGATACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-501s1c1
Sequence:CCGGGCCAGAAGTTGGATTTCTTCACTCGAGTGAAGAAATCCAACTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-937s1c1
Sequence:CCGGGAGTGGCACTATTATGTACCACTCGAGTGGTACATAATAGTGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-722s1c1
Sequence:CCGGCTCATCATCTACATCGAGGAACTCGAGTTCCTCGATGTAGATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-322s1c1
Sequence:CCGGGCTTCTCGATTTCTTGTGTATCTCGAGATACACAAGAAATCGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001362.1-502s1c1
Sequence:CCGGCCAGAAGTTGGATTTCTTCAACTCGAGTTGAAGAAATCCAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks