EMAIL THIS PAGE TO A FRIEND

DIP2A

DIP2 disco-interacting protein 2 homolog A (Drosophila)

Synonyms: C21orf106 DIP2
Gene ID:
Human(23181) Summary: The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(64451) DIP2 disco-interacting protein 2 homolog A (Drosophila)
Rat(690211) DIP2 disco-interacting protein 2 homolog A (Drosophila)
Zebrafish(100332244) DIP2 disco-interacting protein 2 homolog A
cow(518043) DIP2 disco-interacting protein 2 homolog A (Drosophila)
Horse(100054979) DIP2 disco-interacting protein 2 homolog A (Drosophila)
domestic cat(101101579) DIP2 disco-interacting protein 2 homolog A (Drosophila)
dog(491614) DIP2 disco-interacting protein 2 homolog A (Drosophila)
chicken(771400) DIP2 disco-interacting protein 2 homolog A (Drosophila)
sheep(101107497) DIP2 disco-interacting protein 2 homolog A (Drosophila)
domestic guinea pig(100727177) DIP2 disco-interacting protein 2 homolog A (Drosophila)
naked mole-rat(101716913) DIP2 disco-interacting protein 2 homolog A (Drosophila)
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015151 Rosetta Predictions human pricing
NM_206889 Rosetta Predictions human pricing
NM_206890 Rosetta Predictions human pricing
NM_206891 Rosetta Predictions human pricing
XM_001070487 Rosetta Predictions rat pricing
XM_001070526 Rosetta Predictions rat pricing
NM_001081419 Rosetta Predictions mouse pricing
XM_147419 Rosetta Predictions mouse pricing
XM_898682 Rosetta Predictions mouse pricing
XM_898691 Rosetta Predictions mouse pricing
XM_898700 Rosetta Predictions mouse pricing
XM_986714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079490 predicted 277
2 SASI_Hs01_00079491 predicted 289
3 SASI_Hs01_00079492 predicted 2250
4 SASI_Hs01_00079493 predicted 1250
5 SASI_Hs01_00079494 predicted 1935
6 SASI_Hs01_00079495 predicted 2294
7 SASI_Hs01_00079496 predicted 1281
8 SASI_Hs01_00079497 predicted 2241
9 SASI_Hs01_00079498 predicted 1845
10 SASI_Hs02_00347105 predicted 1375
11 SASI_Hs01_00079489 predicted 2327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208555 predicted 274
2 SASI_Hs01_00208556 predicted 288
3 SASI_Hs01_00208557 predicted 2248
4 SASI_Hs01_00208558 predicted 1251
5 SASI_Hs01_00208559 predicted 1936
6 SASI_Hs01_00208560 predicted 2297
7 SASI_Hs01_00208561 predicted 1285
8 SASI_Hs01_00208562 predicted 2242
9 SASI_Hs01_00208563 predicted 1852
10 SASI_Hs02_00373581 predicted 1377
11 SASI_Hs01_00208554 predicted 2328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152704 predicted 281
2 SASI_Hs01_00152705 predicted 288
3 SASI_Hs01_00152706 predicted 2250
4 SASI_Hs01_00152707 predicted 1251
5 SASI_Hs01_00152708 predicted 1927
6 SASI_Hs01_00152709 predicted 2293
7 SASI_Hs01_00152710 predicted 1281
8 SASI_Hs01_00152711 predicted 2235
9 SASI_Hs01_00152712 predicted 1845
10 SASI_Hs02_00373582 predicted 1381
11 SASI_Hs01_00152703 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232093 predicted 281
2 SASI_Hs01_00232094 predicted 289
3 SASI_Hs01_00232095 predicted 2253
4 SASI_Hs01_00232096 predicted 1252
5 SASI_Hs01_00232097 predicted 1934
6 SASI_Hs01_00232098 predicted 2296
7 SASI_Hs01_00232099 predicted 1283
8 SASI_Hs01_00232100 predicted 2235
9 SASI_Hs01_00232101 predicted 1848
10 SASI_Hs02_00373583 predicted 1380
11 SASI_Hs01_00232092 predicted 2327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331838 predicted 473
2 SASI_Rn02_00331839 predicted 1771
3 SASI_Rn02_00331840 predicted 3202
4 SASI_Rn02_00331841 predicted 1949
5 SASI_Rn02_00331842 predicted 386
6 SASI_Rn02_00331843 predicted 1723
7 SASI_Rn02_00331844 predicted 1152
8 SASI_Rn02_00331845 predicted 4633
9 SASI_Rn02_00331846 predicted 1640
10 SASI_Rn02_00331847 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331945 predicted 567
2 SASI_Rn02_00331946 predicted 1855
3 SASI_Rn02_00331947 predicted 3285
4 SASI_Rn02_00331948 predicted 336
5 SASI_Rn02_00331949 predicted 2032
6 SASI_Rn02_00331950 predicted 476
7 SASI_Rn02_00331951 predicted 1809
8 SASI_Rn02_00331952 predicted 1243
9 SASI_Rn02_00331953 predicted 4726
10 SASI_Rn02_00331954 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298201 predicted 1685
2 SASI_Mm02_00298202 predicted 1714
3 SASI_Mm02_00298203 predicted 3525
4 SASI_Mm02_00298204 predicted 3114
5 SASI_Mm02_00298205 predicted 1166
6 SASI_Mm02_00298206 predicted 1859
7 SASI_Mm02_00298207 predicted 3218
8 SASI_Mm02_00298208 predicted 1810
9 SASI_Mm02_00298209 predicted 2430
10 SASI_Mm02_00298210 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_147419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252250 predicted 1719
2 SASI_Mm01_00252251 predicted 3502
3 SASI_Mm01_00252252 predicted 3086
4 SASI_Mm01_00252253 predicted 1175
5 SASI_Mm01_00252254 predicted 1870
6 SASI_Mm01_00252255 predicted 3200
7 SASI_Mm01_00252256 predicted 1590
8 SASI_Mm01_00252257 predicted 1819
9 SASI_Mm01_00252258 predicted 2434
10 SASI_Mm01_00252259 predicted 1743
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253514 predicted 565
2 SASI_Mm01_00253515 predicted 1693
3 SASI_Mm01_00253516 predicted 1724
4 SASI_Mm01_00253517 predicted 1767
5 SASI_Mm01_00253518 predicted 1184
6 SASI_Mm01_00253519 predicted 1171
7 SASI_Mm01_00253520 predicted 1895
8 SASI_Mm01_00253521 predicted 1585
9 SASI_Mm01_00253522 predicted 1817
10 SASI_Mm01_00253523 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280684 predicted 1946
2 SASI_Mm01_00280685 predicted 1098
3 SASI_Mm01_00280686 predicted 1327
4 SASI_Mm01_00280687 predicted 1307
5 SASI_Mm01_00280688 predicted 1000
6 SASI_Mm01_00280689 predicted 1220
7 SASI_Mm01_00280690 predicted 1431
8 SASI_Mm01_00280691 predicted 2294
9 SASI_Mm01_00280692 predicted 2113
10 SASI_Mm01_00280693 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203228 predicted 2264
2 SASI_Mm01_00203229 predicted 1099
3 SASI_Mm01_00203230 predicted 2002
4 SASI_Mm01_00203231 predicted 1592
5 SASI_Mm01_00203232 predicted 365
6 SASI_Mm01_00203233 predicted 1697
7 SASI_Mm01_00203234 predicted 1259
8 SASI_Mm01_00203235 predicted 322
9 SASI_Mm01_00203236 predicted 936
10 SASI_Mm01_00203237 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259227 predicted 1716
2 SASI_Mm01_00259228 predicted 3539
3 SASI_Mm01_00259229 predicted 3116
4 SASI_Mm01_00259230 predicted 1168
5 SASI_Mm01_00259231 predicted 1864
6 SASI_Mm01_00259232 predicted 3230
7 SASI_Mm01_00259233 predicted 1593
8 SASI_Mm01_00259234 predicted 1818
9 SASI_Mm01_00259235 predicted 2426
10 SASI_Mm01_00259236 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015151
VALIDATED
DIP2A MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015151.2-3620s1c1
Sequence:CCGGCGTGTCAACCACTGGGATATTCTCGAGAATATCCCAGTGGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015151.2-5194s21c1
Sequence:CCGGTTGCACTTTCTTTAGGCTAAACTCGAGTTTAGCCTAAAGAAAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4346s21c1
Sequence:CCGGCACCGGGTACTACACCGTTTACTCGAGTAAACGGTGTAGTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-1679s21c1
Sequence:CCGGGACTGCCTACATTGAGTATAACTCGAGTTATACTCAATGTAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015151.2-1351s21c1
Sequence:CCGGTGGCGCTCGTGTTTCCGAATACTCGAGTATTCGGAAACACGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4607s21c1
Sequence:CCGGCATCGCTGAGTGTGCCGTATTCTCGAGAATACGGCACACTCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015151
VALIDATED
DIP2A MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015151.2-3620s1c1
Sequence:CCGGCGTGTCAACCACTGGGATATTCTCGAGAATATCCCAGTGGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015151.2-5194s21c1
Sequence:CCGGTTGCACTTTCTTTAGGCTAAACTCGAGTTTAGCCTAAAGAAAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4346s21c1
Sequence:CCGGCACCGGGTACTACACCGTTTACTCGAGTAAACGGTGTAGTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-1679s21c1
Sequence:CCGGGACTGCCTACATTGAGTATAACTCGAGTTATACTCAATGTAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015151.2-1351s21c1
Sequence:CCGGTGGCGCTCGTGTTTCCGAATACTCGAGTATTCGGAAACACGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4607s21c1
Sequence:CCGGCATCGCTGAGTGTGCCGTATTCTCGAGAATACGGCACACTCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015151
VALIDATED
DIP2A MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015151.2-3620s1c1
Sequence:CCGGCGTGTCAACCACTGGGATATTCTCGAGAATATCCCAGTGGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015151.2-5194s21c1
Sequence:CCGGTTGCACTTTCTTTAGGCTAAACTCGAGTTTAGCCTAAAGAAAGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4346s21c1
Sequence:CCGGCACCGGGTACTACACCGTTTACTCGAGTAAACGGTGTAGTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-1679s21c1
Sequence:CCGGGACTGCCTACATTGAGTATAACTCGAGTTATACTCAATGTAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015151.2-1351s21c1
Sequence:CCGGTGGCGCTCGTGTTTCCGAATACTCGAGTATTCGGAAACACGAGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015151.2-4607s21c1
Sequence:CCGGCATCGCTGAGTGTGCCGTATTCTCGAGAATACGGCACACTCAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206891
VALIDATED
DIP2A MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1853s1c1
Sequence:CCGGCGTGTTAACAAGCGTCATGAACTCGAGTTCATGACGCTTGTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-2242s1c1
Sequence:CCGGACGGTCTAAGTTATGGTGTTACTCGAGTAACACCATAACTTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1435s1c1
Sequence:CCGGCCATAGAAGTGCCATTAACAACTCGAGTTGTTAATGGCACTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-2325s1c1
Sequence:CCGGCCTGGAGCTAATGTATGTGTTCTCGAGAACACATACATTAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-294s1c1
Sequence:CCGGGCACGTTATATACCGCTTATTCTCGAGAATAAGCGGTATATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206891
VALIDATED
DIP2A MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1853s1c1
Sequence:CCGGCGTGTTAACAAGCGTCATGAACTCGAGTTCATGACGCTTGTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-2242s1c1
Sequence:CCGGACGGTCTAAGTTATGGTGTTACTCGAGTAACACCATAACTTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1435s1c1
Sequence:CCGGCCATAGAAGTGCCATTAACAACTCGAGTTGTTAATGGCACTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-2325s1c1
Sequence:CCGGCCTGGAGCTAATGTATGTGTTCTCGAGAACACATACATTAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-294s1c1
Sequence:CCGGGCACGTTATATACCGCTTATTCTCGAGAATAAGCGGTATATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206891
VALIDATED
DIP2A MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1853s1c1
Sequence:CCGGCGTGTTAACAAGCGTCATGAACTCGAGTTCATGACGCTTGTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-2242s1c1
Sequence:CCGGACGGTCTAAGTTATGGTGTTACTCGAGTAACACCATAACTTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206891.1-1435s1c1
Sequence:CCGGCCATAGAAGTGCCATTAACAACTCGAGTTGTTAATGGCACTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-2325s1c1
Sequence:CCGGCCTGGAGCTAATGTATGTGTTCTCGAGAACACATACATTAGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_206891.1-294s1c1
Sequence:CCGGGCACGTTATATACCGCTTATTCTCGAGAATAAGCGGTATATAACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081419
VALIDATED
DIP2A MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000258155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-480s21c1
Sequence:CCGGTCAGAAGATGAGGGCTCTTTACTCGAGTAAAGAGCCCTCATCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-277s21c1
Sequence:CCGGTGACGGCAGCTACCGCTAAACCTCGAGGTTTAGCGGTAGCTGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-164s21c1
Sequence:CCGGCACTCAGAAAGGATATGAGAACTCGAGTTCTCATATCCTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-301s21c1
Sequence:CCGGAGAAGTCTCGGGCTACCAACTCTCGAGAGTTGGTAGCCCGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081419
VALIDATED
DIP2A MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000258155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-480s21c1
Sequence:CCGGTCAGAAGATGAGGGCTCTTTACTCGAGTAAAGAGCCCTCATCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-277s21c1
Sequence:CCGGTGACGGCAGCTACCGCTAAACCTCGAGGTTTAGCGGTAGCTGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-164s21c1
Sequence:CCGGCACTCAGAAAGGATATGAGAACTCGAGTTCTCATATCCTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-301s21c1
Sequence:CCGGAGAAGTCTCGGGCTACCAACTCTCGAGAGTTGGTAGCCCGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081419
VALIDATED
DIP2A MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog A (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000258155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-480s21c1
Sequence:CCGGTCAGAAGATGAGGGCTCTTTACTCGAGTAAAGAGCCCTCATCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-277s21c1
Sequence:CCGGTGACGGCAGCTACCGCTAAACCTCGAGGTTTAGCGGTAGCTGCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081419.1-164s21c1
Sequence:CCGGCACTCAGAAAGGATATGAGAACTCGAGTTCTCATATCCTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081419.1-301s21c1
Sequence:CCGGAGAAGTCTCGGGCTACCAACTCTCGAGAGTTGGTAGCCCGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks