EMAIL THIS PAGE TO A FRIEND

DIP2B

DIP2 disco-interacting protein 2 homolog B (Drosophila)

207 Gene Product Result for
UniProtKB ID: Q9P265, Q6B011, Q8N1L5, Q8NB38
Gene ID:
Human(57609) Summary: This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Mouse(239667) DIP2 disco-interacting protein 2 homolog B (Drosophila)
Rat(300231) DIP2 disco-interacting protein 2 homolog B (Drosophila)
chicken(426874) DIP2 disco-interacting protein 2 homolog B (Drosophila)
dog(477608) DIP2 disco-interacting protein 2 homolog B (Drosophila)
Horse(100060190) DIP2 disco-interacting protein 2 homolog B (Drosophila)
cow(512064) DIP2 disco-interacting protein 2 homolog B (Drosophila)
domestic cat(101088005) DIP2 disco-interacting protein 2 homolog B (Drosophila)
naked mole-rat(101697433) DIP2 disco-interacting protein 2 homolog B (Drosophila)
domestic guinea pig(100735960) DIP2 disco-interacting protein 2 homolog B (Drosophila)
sheep(101116899) DIP2 disco-interacting protein 2 homolog B (Drosophila)
Domestic Rabbit(100340998) DIP2 disco-interacting protein 2 homolog B (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173602 Rosetta Predictions human pricing
XM_001063280 Rosetta Predictions rat pricing
XM_235656 Rosetta Predictions rat pricing
NM_172819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093849 predicted 4692
2 SASI_Hs01_00093851 predicted 1527
3 SASI_Hs02_00368462 predicted 4569
4 SASI_Hs02_00368463 predicted 3327
5 SASI_Hs01_00093852 predicted 2560
6 SASI_Hs01_00093853 predicted 1379
7 SASI_Hs01_00093854 predicted 432
8 SASI_Hs01_00093855 predicted 3349
9 SASI_Hs02_00368464 predicted 924
10 SASI_Hs01_00093856 predicted 3828
11 SASI_Hs01_00093850 predicted 3949
12 SASI_Hs01_00093857 predicted 3581
13 SASI_Hs01_00093858 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306492 predicted 3675
2 SASI_Rn02_00306493 predicted 2775
3 SASI_Rn02_00306494 predicted 1541
4 SASI_Rn02_00306495 predicted 1789
5 SASI_Rn02_00306496 predicted 4722
6 SASI_Rn02_00306497 predicted 3450
7 SASI_Rn02_00306498 predicted 1270
8 SASI_Rn02_00306499 predicted 4894
9 SASI_Rn02_00306500 predicted 4337
10 SASI_Rn02_00306501 predicted 3395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389556 predicted 2781
2 SASI_Rn02_00389557 predicted 755
3 SASI_Rn02_00389558 predicted 1537
4 SASI_Rn02_00389559 predicted 1794
5 SASI_Rn02_00389560 predicted 4724
6 SASI_Rn02_00389561 predicted 1269
7 SASI_Rn02_00389562 predicted 4893
8 SASI_Rn02_00389563 predicted 4334
9 SASI_Rn02_00389564 predicted 1957
10 SASI_Rn02_00389565 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028910 predicted 3765
2 SASI_Mm02_00344745 predicted 3559
3 SASI_Mm01_00028911 predicted 2804
4 SASI_Mm01_00028912 predicted 2610
5 SASI_Mm01_00028913 predicted 2548
6 SASI_Mm01_00028914 predicted 4057
7 SASI_Mm01_00028915 predicted 3167
8 SASI_Mm01_00028916 predicted 3310
9 SASI_Mm01_00028917 predicted 446
10 SASI_Mm01_00028918 predicted 492
11 SASI_Mm01_00028919 predicted 2020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020849
VALIDATED
DIP2B MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-577s1c1
Sequence:CCGGGCTACTGGATTGGCTGTAGAACTCGAGTTCTACAGCCAATCCAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-2671s1c1
Sequence:CCGGGAAGAGCATTACCTCATCGTTCTCGAGAACGATGAGGTAATGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-173s1c1
Sequence:CCGGCCATTCTCTCAATGAATGGATCTCGAGATCCATTCATTGAGAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1485s1c1
Sequence:CCGGCACAGATGATTTACCCAGGAACTCGAGTTCCTGGGTAAATCATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-1537s1c1
Sequence:CCGGCCTGAGATGTTGGCATATCTTCTCGAGAAGATATGCCAACATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-456s1c1
Sequence:CCGGGCCATTCATCCGATCAGGATTCTCGAGAATCCTGATCGGATGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-249s1c1
Sequence:CCGGCCAGGATGTAGGGCATGTAATCTCGAGATTACATGCCCTACATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-2498s1c1
Sequence:CCGGGAGGATTACGATACCACCCAACTCGAGTTGGGTGGTATCGTAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-673s1c1
Sequence:CCGGGTTGCGGAACAAAGACCTGATCTCGAGATCAGGTCTTTGTTCCGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1653s1c1
Sequence:CCGGGTTGTACTCTTCTCGGCAGATCTCGAGATCTGCCGAGAAGAGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1749s1c1
Sequence:CCGGGTCTGTCTTAATTCCTCCTATCTCGAGATAGGAGGAATTAAGACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020849
VALIDATED
DIP2B MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-577s1c1
Sequence:CCGGGCTACTGGATTGGCTGTAGAACTCGAGTTCTACAGCCAATCCAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-2671s1c1
Sequence:CCGGGAAGAGCATTACCTCATCGTTCTCGAGAACGATGAGGTAATGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-173s1c1
Sequence:CCGGCCATTCTCTCAATGAATGGATCTCGAGATCCATTCATTGAGAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1485s1c1
Sequence:CCGGCACAGATGATTTACCCAGGAACTCGAGTTCCTGGGTAAATCATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-1537s1c1
Sequence:CCGGCCTGAGATGTTGGCATATCTTCTCGAGAAGATATGCCAACATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-456s1c1
Sequence:CCGGGCCATTCATCCGATCAGGATTCTCGAGAATCCTGATCGGATGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-249s1c1
Sequence:CCGGCCAGGATGTAGGGCATGTAATCTCGAGATTACATGCCCTACATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-2498s1c1
Sequence:CCGGGAGGATTACGATACCACCCAACTCGAGTTGGGTGGTATCGTAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-673s1c1
Sequence:CCGGGTTGCGGAACAAAGACCTGATCTCGAGATCAGGTCTTTGTTCCGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1653s1c1
Sequence:CCGGGTTGTACTCTTCTCGGCAGATCTCGAGATCTGCCGAGAAGAGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1749s1c1
Sequence:CCGGGTCTGTCTTAATTCCTCCTATCTCGAGATAGGAGGAATTAAGACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020849
VALIDATED
DIP2B MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-577s1c1
Sequence:CCGGGCTACTGGATTGGCTGTAGAACTCGAGTTCTACAGCCAATCCAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_020849.1-2671s1c1
Sequence:CCGGGAAGAGCATTACCTCATCGTTCTCGAGAACGATGAGGTAATGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-173s1c1
Sequence:CCGGCCATTCTCTCAATGAATGGATCTCGAGATCCATTCATTGAGAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1485s1c1
Sequence:CCGGCACAGATGATTTACCCAGGAACTCGAGTTCCTGGGTAAATCATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-1537s1c1
Sequence:CCGGCCTGAGATGTTGGCATATCTTCTCGAGAAGATATGCCAACATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-456s1c1
Sequence:CCGGGCCATTCATCCGATCAGGATTCTCGAGAATCCTGATCGGATGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020849.1-249s1c1
Sequence:CCGGCCAGGATGTAGGGCATGTAATCTCGAGATTACATGCCCTACATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-2498s1c1
Sequence:CCGGGAGGATTACGATACCACCCAACTCGAGTTGGGTGGTATCGTAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-673s1c1
Sequence:CCGGGTTGCGGAACAAAGACCTGATCTCGAGATCAGGTCTTTGTTCCGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142141    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1653s1c1
Sequence:CCGGGTTGTACTCTTCTCGGCAGATCTCGAGATCTGCCGAGAAGAGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020849.1-1749s1c1
Sequence:CCGGGTCTGTCTTAATTCCTCCTATCTCGAGATAGGAGGAATTAAGACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172819
VALIDATED
DIP2B MISSION shRNA Bacterial Glycerol Stock
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2051s1c1
Sequence:CCGGGCCAGCTAACACGTTACCAAACTCGAGTTTGGTAACGTGTTAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2815s1c1
Sequence:CCGGCGTATCTTGATTTCAGCGTTTCTCGAGAAACGCTGAAATCAAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2656s1c1
Sequence:CCGGCGTGTGTCCTTACCACTCAAACTCGAGTTTGAGTGGTAAGGACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-4058s1c1
Sequence:CCGGCCCTATCTATGTGGCTTACAACTCGAGTTGTAAGCCACATAGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-3437s1c1
Sequence:CCGGGCTTTCTGAATCTGGAAAGATCTCGAGATCTTTCCAGATTCAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172819
VALIDATED
DIP2B MISSION shRNA shRNA Plasmid DNA
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2051s1c1
Sequence:CCGGGCCAGCTAACACGTTACCAAACTCGAGTTTGGTAACGTGTTAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2815s1c1
Sequence:CCGGCGTATCTTGATTTCAGCGTTTCTCGAGAAACGCTGAAATCAAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2656s1c1
Sequence:CCGGCGTGTGTCCTTACCACTCAAACTCGAGTTTGAGTGGTAAGGACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-4058s1c1
Sequence:CCGGCCCTATCTATGTGGCTTACAACTCGAGTTGTAAGCCACATAGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-3437s1c1
Sequence:CCGGGCTTTCTGAATCTGGAAAGATCTCGAGATCTTTCCAGATTCAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172819
VALIDATED
DIP2B MISSION shRNA Lentiviral Transduction Particles
DIP2 disco-interacting protein 2 homolog B (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2051s1c1
Sequence:CCGGGCCAGCTAACACGTTACCAAACTCGAGTTTGGTAACGTGTTAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2815s1c1
Sequence:CCGGCGTATCTTGATTTCAGCGTTTCTCGAGAAACGCTGAAATCAAGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-2656s1c1
Sequence:CCGGCGTGTGTCCTTACCACTCAAACTCGAGTTTGAGTGGTAAGGACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-4058s1c1
Sequence:CCGGCCCTATCTATGTGGCTTACAACTCGAGTTGTAAGCCACATAGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172819.1-3437s1c1
Sequence:CCGGGCTTTCTGAATCTGGAAAGATCTCGAGATCTTTCCAGATTCAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)