EMAIL THIS PAGE TO A FRIEND

DIRAS1

DIRAS family, GTP-binding RAS-like 1

92 Gene Product Result for
Synonyms: Di-Ras1 GBTS1 RIG
UniProtKB ID: O95057
Gene ID:
Human(148252) Summary: DIRAS1 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.[supplied by OMIM, Apr 2004]
Mouse(208666) DIRAS family, GTP-binding RAS-like 1
Rat(366826) DIRAS family, GTP-binding RAS-like 1
cow(618387) DIRAS family, GTP-binding RAS-like 1
dog(485068) DIRAS family, GTP-binding RAS-like 1
domestic cat(101088466) DIRAS family, GTP-binding RAS-like 1
sheep(101120078) DIRAS family, GTP-binding RAS-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145173 Rosetta Predictions human pricing
NM_001108987 Rosetta Predictions rat pricing
NM_145217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139583 predicted 571
2 SASI_Hs01_00139589 predicted 554
3 SASI_Hs02_00365027 predicted 552
4 SASI_Hs02_00365028 predicted 643
5 SASI_Hs01_00139591 predicted 640
6 SASI_Hs02_00365029 predicted 501
7 SASI_Hs01_00139584 predicted 217
8 SASI_Hs02_00365030 predicted 1016
9 SASI_Hs01_00139585 predicted 292
10 SASI_Hs01_00139586 predicted 1029
11 SASI_Hs01_00139587 predicted 655
12 SASI_Hs01_00139588 predicted 270
13 SASI_Hs01_00139590 predicted 1128
14 SASI_Hs01_00139592 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244054 predicted 326
2 SASI_Rn02_00244055 predicted 244
3 SASI_Rn02_00244056 predicted 254
4 SASI_Rn02_00244057 predicted 383
5 SASI_Rn02_00244058 predicted 232
6 SASI_Rn02_00244059 predicted 297
7 SASI_Rn02_00244060 predicted 216
8 SASI_Rn02_00244061 predicted 513
9 SASI_Rn02_00244062 predicted 1030
10 SASI_Rn02_00244063 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051787 predicted 329
2 SASI_Mm01_00051788 predicted 1096
3 SASI_Mm01_00051790 predicted 244
4 SASI_Mm01_00051791 predicted 967
5 SASI_Mm01_00051792 predicted 959
6 SASI_Mm01_00051793 predicted 541
7 SASI_Mm01_00051794 predicted 1037
8 SASI_Mm01_00051795 predicted 1084
9 SASI_Mm01_00051796 predicted 1029
10 SASI_Mm02_00340591 predicted 934
11 SASI_Mm01_00051789 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145173
VALIDATED
DIRAS1 MISSION shRNA Bacterial Glycerol Stock
DIRAS family, GTP-binding RAS-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-733s21c1
Sequence:CCGGAGGGCAAATGCACCCTCATGTCTCGAGACATGAGGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1229s21c1
Sequence:CCGGTTTCTCCTATTTGGTGTTAACCTCGAGGTTAACACCAAATAGGAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-554s1c2
Sequence:CCGGCCAGGAGTGGAAGTGCGCTTTCTCGAGAAAGCGCACTTCCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-248s21c1
Sequence:CCGGCACGTTCCGCGACACCTACATCTCGAGATGTAGGTGTCGCGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1140s21c1
Sequence:CCGGCGCGTCCTGTCCCTCACATTTCTCGAGAAATGTGAGGGACAGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-647s1c1
Sequence:CCGGCCGGAACATGAGCCTCAACATCTCGAGATGTTGAGGCTCATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145173.1-590s1c1
Sequence:CCGGCAAGATGAACTACAACGTCAACTCGAGTTGACGTTGTAGTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-2262s1c1
Sequence:CCGGCCACAAATGTAGCAACCAGAACTCGAGTTCTGGTTGCTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-437s1c1
Sequence:CCGGCTACAAGCTCATCGTGCAGATCTCGAGATCTGCACGATGAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145173
VALIDATED
DIRAS1 MISSION shRNA shRNA Plasmid DNA
DIRAS family, GTP-binding RAS-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-733s21c1
Sequence:CCGGAGGGCAAATGCACCCTCATGTCTCGAGACATGAGGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1229s21c1
Sequence:CCGGTTTCTCCTATTTGGTGTTAACCTCGAGGTTAACACCAAATAGGAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-554s1c2
Sequence:CCGGCCAGGAGTGGAAGTGCGCTTTCTCGAGAAAGCGCACTTCCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-248s21c1
Sequence:CCGGCACGTTCCGCGACACCTACATCTCGAGATGTAGGTGTCGCGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1140s21c1
Sequence:CCGGCGCGTCCTGTCCCTCACATTTCTCGAGAAATGTGAGGGACAGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-647s1c1
Sequence:CCGGCCGGAACATGAGCCTCAACATCTCGAGATGTTGAGGCTCATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145173.1-590s1c1
Sequence:CCGGCAAGATGAACTACAACGTCAACTCGAGTTGACGTTGTAGTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-2262s1c1
Sequence:CCGGCCACAAATGTAGCAACCAGAACTCGAGTTCTGGTTGCTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-437s1c1
Sequence:CCGGCTACAAGCTCATCGTGCAGATCTCGAGATCTGCACGATGAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145173
VALIDATED
DIRAS1 MISSION shRNA Lentiviral Transduction Particles
DIRAS family, GTP-binding RAS-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-733s21c1
Sequence:CCGGAGGGCAAATGCACCCTCATGTCTCGAGACATGAGGGTGCATTTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1229s21c1
Sequence:CCGGTTTCTCCTATTTGGTGTTAACCTCGAGGTTAACACCAAATAGGAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-554s1c2
Sequence:CCGGCCAGGAGTGGAAGTGCGCTTTCTCGAGAAAGCGCACTTCCACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145173.3-248s21c1
Sequence:CCGGCACGTTCCGCGACACCTACATCTCGAGATGTAGGTGTCGCGGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145173.3-1140s21c1
Sequence:CCGGCGCGTCCTGTCCCTCACATTTCTCGAGAAATGTGAGGGACAGGACGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-647s1c1
Sequence:CCGGCCGGAACATGAGCCTCAACATCTCGAGATGTTGAGGCTCATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145173.1-590s1c1
Sequence:CCGGCAAGATGAACTACAACGTCAACTCGAGTTGACGTTGTAGTTCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-2262s1c1
Sequence:CCGGCCACAAATGTAGCAACCAGAACTCGAGTTCTGGTTGCTACATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145173.1-437s1c1
Sequence:CCGGCTACAAGCTCATCGTGCAGATCTCGAGATCTGCACGATGAGCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145217
DIRAS1 MISSION shRNA Bacterial Glycerol Stock
DIRAS family, GTP-binding RAS-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145217.2-968s1c1
Sequence:CCGGCCTCTCCCTCTATATCTCTTTCTCGAGAAAGAGATATAGAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-394s1c1
Sequence:CCGGCTACAAGTTGATCGTGCAGATCTCGAGATCTGCACGATCAACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-541s1c1
Sequence:CCGGCTCAGCGAAGATGAACTACAACTCGAGTTGTAGTTCATCTTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-194s1c1
Sequence:CCGGGACACCTACATCCCTACCATACTCGAGTATGGTAGGGATGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-331s1c1
Sequence:CCGGCCACGCCTTTATCCTGGTGTTCTCGAGAACACCAGGATAAAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145217
DIRAS1 MISSION shRNA shRNA Plasmid DNA
DIRAS family, GTP-binding RAS-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145217.2-968s1c1
Sequence:CCGGCCTCTCCCTCTATATCTCTTTCTCGAGAAAGAGATATAGAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-394s1c1
Sequence:CCGGCTACAAGTTGATCGTGCAGATCTCGAGATCTGCACGATCAACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-541s1c1
Sequence:CCGGCTCAGCGAAGATGAACTACAACTCGAGTTGTAGTTCATCTTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-194s1c1
Sequence:CCGGGACACCTACATCCCTACCATACTCGAGTATGGTAGGGATGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-331s1c1
Sequence:CCGGCCACGCCTTTATCCTGGTGTTCTCGAGAACACCAGGATAAAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145217
DIRAS1 MISSION shRNA Lentiviral Transduction Particles
DIRAS family, GTP-binding RAS-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145217.2-968s1c1
Sequence:CCGGCCTCTCCCTCTATATCTCTTTCTCGAGAAAGAGATATAGAGGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-394s1c1
Sequence:CCGGCTACAAGTTGATCGTGCAGATCTCGAGATCTGCACGATCAACTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-541s1c1
Sequence:CCGGCTCAGCGAAGATGAACTACAACTCGAGTTGTAGTTCATCTTCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-194s1c1
Sequence:CCGGGACACCTACATCCCTACCATACTCGAGTATGGTAGGGATGTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145217.2-331s1c1
Sequence:CCGGCCACGCCTTTATCCTGGTGTTCTCGAGAACACCAGGATAAAGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks