EMAIL THIS PAGE TO A FRIEND

DIRAS2

DIRAS family, GTP-binding RAS-like 2

168 Gene Product Result for
Synonyms: Di-Ras2
UniProtKB ID: Q96HU8, B3KVM2
Gene ID:
Human(54769) Summary: DIRAS2 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.[supplied by OMIM, Apr 2004]
Mouse(68203) DIRAS family, GTP-binding RAS-like 2
Rat(291006) DIRAS family, GTP-binding RAS-like 2
chicken(425241) DIRAS family, GTP-binding RAS-like 2
cow(538667) DIRAS family, GTP-binding RAS-like 2
domestic cat(101086757) DIRAS family, GTP-binding RAS-like 2
dog(484197) DIRAS family, GTP-binding RAS-like 2
domestic guinea pig(100731239) DIRAS family, GTP-binding RAS-like 2
naked mole-rat(101720081) DIRAS family, GTP-binding RAS-like 2
sheep(101105051) DIRAS family, GTP-binding RAS-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017594 Rosetta Predictions human pricing
XM_001053689 Rosetta Predictions rat pricing
XM_225214 Rosetta Predictions rat pricing
NM_001024474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130231 predicted 1037
2 SASI_Hs01_00130232 predicted 555
3 SASI_Hs01_00130233 predicted 529
4 SASI_Hs01_00130234 predicted 1064
5 SASI_Hs01_00130235 predicted 1009
6 SASI_Hs01_00130236 predicted 1051
7 SASI_Hs01_00130237 predicted 226
8 SASI_Hs01_00130238 predicted 1020
9 SASI_Hs01_00130239 predicted 1168
10 SASI_Hs01_00130240 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273230 predicted 365
2 SASI_Rn02_00273231 predicted 1018
3 SASI_Rn02_00273232 predicted 436
4 SASI_Rn02_00273233 predicted 719
5 SASI_Rn02_00273234 predicted 565
6 SASI_Rn02_00273235 predicted 979
7 SASI_Rn02_00273236 predicted 869
8 SASI_Rn02_00273237 predicted 586
9 SASI_Rn02_00273238 predicted 868
10 SASI_Rn02_00273239 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382627 predicted 753
2 SASI_Rn02_00382628 predicted 265
3 SASI_Rn02_00382629 predicted 763
4 SASI_Rn02_00382630 predicted 468
5 SASI_Rn02_00382631 predicted 310
6 SASI_Rn02_00382632 predicted 726
7 SASI_Rn02_00382633 predicted 617
8 SASI_Rn02_00382634 predicted 326
9 SASI_Rn02_00382635 predicted 634
10 SASI_Rn02_00382636 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174611 predicted 1286
2 SASI_Mm01_00174612 predicted 1487
3 SASI_Mm01_00174613 predicted 735
4 SASI_Mm01_00174614 predicted 1039
5 SASI_Mm01_00174616 predicted 756
6 SASI_Mm01_00174617 predicted 1172
7 SASI_Mm01_00174618 predicted 506
8 SASI_Mm01_00174619 predicted 1175
9 SASI_Mm01_00174620 predicted 1438
10 SASI_Mm02_00287589 predicted 1277
11 SASI_Mm01_00174615 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017594
DIRAS2 MISSION shRNA Bacterial Glycerol Stock
DIRAS family, GTP-binding RAS-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017594.3-3168s1c1
Sequence:CCGGGCCTCAATTATGGGTCTTCATCTCGAGATGAAGACCCATAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-402s1c1
Sequence:CCGGCAAGCCCATCTACGAACAAATCTCGAGATTTGTTCGTAGATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-414s1c1
Sequence:CCGGCGAACAAATCTGCGAGATCAACTCGAGTTGATCTCGCAGATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-411s1c1
Sequence:CCGGCTACGAACAAATCTGCGAGATCTCGAGATCTCGCAGATTTGTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-534s1c1
Sequence:CCGGCACATGGAAGTGTGCCTTCATCTCGAGATGAAGGCACACTTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-174s21c1
Sequence:CCGGCTCCCTGGTGTTGAGGTTTGTCTCGAGACAAACCTCAACACCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-795s21c1
Sequence:CCGGGTATAATGCCCACGTGTTAAACTCGAGTTTAACACGTGGGCATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-825s21c1
Sequence:CCGGTAATCGAGATGCGTCCTATTGCTCGAGCAATAGGACGCATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-687s21c1
Sequence:CCGGCAAAGGCAAGTGCGTGATCATCTCGAGATGATCACGCACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-1031s21c1
Sequence:CCGGATGTACCGAGAGGACTAAATGCTCGAGCATTTAGTCCTCTCGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017594
DIRAS2 MISSION shRNA shRNA Plasmid DNA
DIRAS family, GTP-binding RAS-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017594.3-3168s1c1
Sequence:CCGGGCCTCAATTATGGGTCTTCATCTCGAGATGAAGACCCATAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-402s1c1
Sequence:CCGGCAAGCCCATCTACGAACAAATCTCGAGATTTGTTCGTAGATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-414s1c1
Sequence:CCGGCGAACAAATCTGCGAGATCAACTCGAGTTGATCTCGCAGATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-411s1c1
Sequence:CCGGCTACGAACAAATCTGCGAGATCTCGAGATCTCGCAGATTTGTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-534s1c1
Sequence:CCGGCACATGGAAGTGTGCCTTCATCTCGAGATGAAGGCACACTTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-174s21c1
Sequence:CCGGCTCCCTGGTGTTGAGGTTTGTCTCGAGACAAACCTCAACACCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-795s21c1
Sequence:CCGGGTATAATGCCCACGTGTTAAACTCGAGTTTAACACGTGGGCATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-825s21c1
Sequence:CCGGTAATCGAGATGCGTCCTATTGCTCGAGCAATAGGACGCATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-687s21c1
Sequence:CCGGCAAAGGCAAGTGCGTGATCATCTCGAGATGATCACGCACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-1031s21c1
Sequence:CCGGATGTACCGAGAGGACTAAATGCTCGAGCATTTAGTCCTCTCGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017594
DIRAS2 MISSION shRNA Lentiviral Transduction Particles
DIRAS family, GTP-binding RAS-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017594.3-3168s1c1
Sequence:CCGGGCCTCAATTATGGGTCTTCATCTCGAGATGAAGACCCATAATTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-402s1c1
Sequence:CCGGCAAGCCCATCTACGAACAAATCTCGAGATTTGTTCGTAGATGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-414s1c1
Sequence:CCGGCGAACAAATCTGCGAGATCAACTCGAGTTGATCTCGCAGATTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-411s1c1
Sequence:CCGGCTACGAACAAATCTGCGAGATCTCGAGATCTCGCAGATTTGTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017594.3-534s1c1
Sequence:CCGGCACATGGAAGTGTGCCTTCATCTCGAGATGAAGGCACACTTCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-174s21c1
Sequence:CCGGCTCCCTGGTGTTGAGGTTTGTCTCGAGACAAACCTCAACACCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-795s21c1
Sequence:CCGGGTATAATGCCCACGTGTTAAACTCGAGTTTAACACGTGGGCATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-825s21c1
Sequence:CCGGTAATCGAGATGCGTCCTATTGCTCGAGCAATAGGACGCATCTCGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017594.3-687s21c1
Sequence:CCGGCAAAGGCAAGTGCGTGATCATCTCGAGATGATCACGCACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017594.3-1031s21c1
Sequence:CCGGATGTACCGAGAGGACTAAATGCTCGAGCATTTAGTCCTCTCGGTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024474
DIRAS2 MISSION shRNA Bacterial Glycerol Stock
DIRAS family, GTP-binding RAS-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024474.1-963s1c1
Sequence:CCGGCGTGTGTTAAACATTGCATTTCTCGAGAAATGCAATGTTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-691s1c1
Sequence:CCGGCCGCACATGGAAGTGCGCCTTCTCGAGAAGGCGCACTTCCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-554s1c1
Sequence:CCGGGAGGAACTCAAGCCCATCTATCTCGAGATAGATGGGCTTGAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-346s1c1
Sequence:CCGGGAGGTTTGTGAAAGGGACCTTCTCGAGAAGGTCCCTTTCACAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-727s1c1
Sequence:CCGGCAAGCTCAACCACAACGTGAACTCGAGTTCACGTTGTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024474
DIRAS2 MISSION shRNA shRNA Plasmid DNA
DIRAS family, GTP-binding RAS-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024474.1-963s1c1
Sequence:CCGGCGTGTGTTAAACATTGCATTTCTCGAGAAATGCAATGTTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-691s1c1
Sequence:CCGGCCGCACATGGAAGTGCGCCTTCTCGAGAAGGCGCACTTCCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-554s1c1
Sequence:CCGGGAGGAACTCAAGCCCATCTATCTCGAGATAGATGGGCTTGAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-346s1c1
Sequence:CCGGGAGGTTTGTGAAAGGGACCTTCTCGAGAAGGTCCCTTTCACAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-727s1c1
Sequence:CCGGCAAGCTCAACCACAACGTGAACTCGAGTTCACGTTGTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024474
DIRAS2 MISSION shRNA Lentiviral Transduction Particles
DIRAS family, GTP-binding RAS-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024474.1-963s1c1
Sequence:CCGGCGTGTGTTAAACATTGCATTTCTCGAGAAATGCAATGTTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-691s1c1
Sequence:CCGGCCGCACATGGAAGTGCGCCTTCTCGAGAAGGCGCACTTCCATGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-554s1c1
Sequence:CCGGGAGGAACTCAAGCCCATCTATCTCGAGATAGATGGGCTTGAGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-346s1c1
Sequence:CCGGGAGGTTTGTGAAAGGGACCTTCTCGAGAAGGTCCCTTTCACAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024474.1-727s1c1
Sequence:CCGGCAAGCTCAACCACAACGTGAACTCGAGTTCACGTTGTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks