EMAIL THIS PAGE TO A FRIEND

DIRAS3

DIRAS family, GTP-binding RAS-like 3

33 Gene Product Result for
Synonyms: ARHI NOEY2
UniProtKB ID: O95661, B3KMP3
Gene ID:
Human(9077) Summary: This gene is a member of the ras superfamily, and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast cancers. It is an imprinted gene, with monoallelic expression of the paternal allele, which is associated with growth suppression. Thus, this gene appears to be a putative tumor suppressor gene whose function is abrogated in ovarian and breast cancers. [provided by RefSeq, Oct 2010]
sheep(100147791) DIRAS family, GTP-binding RAS-like 3
cow(504559) DIRAS family, GTP-binding RAS-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004675 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120761 MISSION® esiRNA esiRNA human DIRAS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208750 predicted 1111
2 SASI_Hs01_00208751 predicted 807
3 SASI_Hs01_00208752 predicted 958
4 SASI_Hs01_00208754 predicted 1098
5 SASI_Hs01_00208755 predicted 1205
6 SASI_Hs01_00208756 predicted 393
7 SASI_Hs01_00208757 predicted 1034
8 SASI_Hs01_00208758 predicted 710
9 SASI_Hs01_00208759 predicted 1109
10 SASI_Hs02_00338107 predicted 469
11 SASI_Hs01_00208753 predicted 1208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004675
DIRAS3 MISSION shRNA Bacterial Glycerol Stock
DIRAS family, GTP-binding RAS-like 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004675.2-486s21c1
Sequence:CCGGATGAGTACCTGCCGACCATTGCTCGAGCAATGGTCGGCAGGTACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1320s21c1
Sequence:CCGGGTAACCCGATTATTGTGTATTCTCGAGAATACACAATAATCGGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1100s21c1
Sequence:CCGGTCCATGTTGTCAATACGTATACTCGAGTATACGTATTGACAACATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-811s1c1
Sequence:CCGGGCTGCTTGACAAGTGCATAATCTCGAGATTATGCACTTGTCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-559s1c1
Sequence:CCGGCAAAGGTAACAACCTGCATAACTCGAGTTATGCAGGTTGTTACCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-689s1c1
Sequence:CCGGTCAGCCAAGACCGATGTGAATCTCGAGATTCACATCGGTCTTGGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-550s1c1
Sequence:CCGGCTGCAAGATCAAAGGTAACAACTCGAGTTGTTACCTTTGATCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-240s1c1
Sequence:CCGGCCCACAGGAAGATCAGAGATTCTCGAGAATCTCTGATCTTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004675
DIRAS3 MISSION shRNA shRNA Plasmid DNA
DIRAS family, GTP-binding RAS-like 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004675.2-486s21c1
Sequence:CCGGATGAGTACCTGCCGACCATTGCTCGAGCAATGGTCGGCAGGTACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1320s21c1
Sequence:CCGGGTAACCCGATTATTGTGTATTCTCGAGAATACACAATAATCGGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1100s21c1
Sequence:CCGGTCCATGTTGTCAATACGTATACTCGAGTATACGTATTGACAACATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-811s1c1
Sequence:CCGGGCTGCTTGACAAGTGCATAATCTCGAGATTATGCACTTGTCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-559s1c1
Sequence:CCGGCAAAGGTAACAACCTGCATAACTCGAGTTATGCAGGTTGTTACCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-689s1c1
Sequence:CCGGTCAGCCAAGACCGATGTGAATCTCGAGATTCACATCGGTCTTGGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-550s1c1
Sequence:CCGGCTGCAAGATCAAAGGTAACAACTCGAGTTGTTACCTTTGATCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-240s1c1
Sequence:CCGGCCCACAGGAAGATCAGAGATTCTCGAGAATCTCTGATCTTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004675
DIRAS3 MISSION shRNA Lentiviral Transduction Particles
DIRAS family, GTP-binding RAS-like 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004675.2-486s21c1
Sequence:CCGGATGAGTACCTGCCGACCATTGCTCGAGCAATGGTCGGCAGGTACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1320s21c1
Sequence:CCGGGTAACCCGATTATTGTGTATTCTCGAGAATACACAATAATCGGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004675.2-1100s21c1
Sequence:CCGGTCCATGTTGTCAATACGTATACTCGAGTATACGTATTGACAACATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-811s1c1
Sequence:CCGGGCTGCTTGACAAGTGCATAATCTCGAGATTATGCACTTGTCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-559s1c1
Sequence:CCGGCAAAGGTAACAACCTGCATAACTCGAGTTATGCAGGTTGTTACCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-689s1c1
Sequence:CCGGTCAGCCAAGACCGATGTGAATCTCGAGATTCACATCGGTCTTGGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-550s1c1
Sequence:CCGGCTGCAAGATCAAAGGTAACAACTCGAGTTGTTACCTTTGATCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004675.1-240s1c1
Sequence:CCGGCCCACAGGAAGATCAGAGATTCTCGAGAATCTCTGATCTTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)