EMAIL THIS PAGE TO A FRIEND

DIRC2

disrupted in renal carcinoma 2

62 Gene Product Result for
Synonyms: RCC4
UniProtKB ID: Q96SL1, A8K561, Q8NBX9
Gene ID:
Human(84925) Summary: This gene encodes a membrane-bound protein from the major facilitator superfamily of transporters. Disruption of this gene by translocation has been associated with haplo-insufficiency and renal cell carcinomas. Alternatively spliced transcript variants have been described, but their biological validity has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(224132) disrupted in renal carcinoma 2 (human)
Rat(303902) disrupted in renal carcinoma 2
Zebrafish(447858) disrupted in renal carcinoma 2
chicken(424246) disrupted in renal carcinoma 2
domestic cat(101092135) disrupted in renal carcinoma 2
cow(783019) disrupted in renal carcinoma 2
dog(478588) disrupted in renal carcinoma 2
sheep(101119362) disrupted in renal carcinoma 2
Domestic Rabbit(100355310) disrupted in renal carcinoma 2
naked mole-rat(101700082) disrupted in renal carcinoma 2
domestic guinea pig(100716137) disrupted in renal carcinoma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086451 MISSION® esiRNA esiRNA human DIRC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032839 Rosetta Predictions human pricing
NM_001012017 Rosetta Predictions rat pricing
XM_573297 Rosetta Predictions rat pricing
NM_153550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224563 predicted 486
2 SASI_Hs01_00224564 predicted 1006
3 SASI_Hs01_00224565 predicted 810
4 SASI_Hs01_00224566 predicted 1230
5 SASI_Hs01_00224567 predicted 632
6 SASI_Hs01_00224568 predicted 1276
7 SASI_Hs01_00224569 predicted 763
8 SASI_Hs01_00224570 predicted 588
9 SASI_Hs01_00224571 predicted 532
10 SASI_Hs01_00224572 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049556 predicted 1569
2 SASI_Rn01_00049557 predicted 1515
3 SASI_Rn02_00200098 predicted 663
4 SASI_Rn01_00049558 predicted 1442
5 SASI_Rn01_00049559 predicted 945
6 SASI_Rn01_00049560 predicted 907
7 SASI_Rn01_00049561 predicted 1233
8 SASI_Rn01_00049562 predicted 1179
9 SASI_Rn01_00049563 predicted 917
10 SASI_Rn01_00049564 predicted 1653
11 SASI_Rn01_00049565 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164152 predicted 1581
2 SASI_Rn01_00164153 predicted 1518
3 SASI_Rn01_00164154 predicted 1454
4 SASI_Rn01_00164155 predicted 948
5 SASI_Rn01_00164156 predicted 905
6 SASI_Rn01_00164157 predicted 1239
7 SASI_Rn01_00164158 predicted 1192
8 SASI_Rn01_00164159 predicted 922
9 SASI_Rn01_00164160 predicted 1652
10 SASI_Rn01_00164161 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343318 predicted 1434
2 SASI_Mm01_00123442 predicted 1096
3 SASI_Mm01_00123443 predicted 1574
4 SASI_Mm01_00123444 predicted 521
5 SASI_Mm01_00123445 predicted 1071
6 SASI_Mm01_00123446 predicted 789
7 SASI_Mm01_00123447 predicted 760
8 SASI_Mm01_00123448 predicted 802
9 SASI_Mm02_00343319 predicted 559
10 SASI_Mm01_00123449 predicted 512
11 SASI_Mm01_00123450 predicted 918
12 SASI_Mm01_00123451 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032839
VALIDATED
DIRC2 MISSION shRNA Bacterial Glycerol Stock
disrupted in renal carcinoma 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-846s21c1
Sequence:CCGGTTGGAGTTGTCTGCTTAATATCTCGAGATATTAAGCAGACAACTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1558s21c1
Sequence:CCGGTGTGGTTGTCTCCGTTTAATACTCGAGTATTAAACGGAGACAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1841s21c1
Sequence:CCGGATAAAGCACTACCTAAGTAATCTCGAGATTACTTAGGTAGTGCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1979s21c1
Sequence:CCGGGATATGCCACTAACTTCTAAACTCGAGTTTAGAAGTTAGTGGCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1522s21c1
Sequence:CCGGGTGCTTCAGGGAATCCTATGACTCGAGTCATAGGATTCCCTGAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-2004s21c1
Sequence:CCGGTTCAAACCCTGTATCCAATTTCTCGAGAAATTGGATACAGGGTTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1318s21c1
Sequence:CCGGGAATAGCAGCGTGCCTATATTCTCGAGAATATAGGCACGCTGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-941s1c1
Sequence:CCGGCGGAGAAGCGTTTGTAGATTACTCGAGTAATCTACAAACGCTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-1001s1c1
Sequence:CCGGGCCATACCACTTGGTGTATTTCTCGAGAAATACACCAAGTGGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-537s1c1
Sequence:CCGGGCATACCTATATCAGACTTAACTCGAGTTAAGTCTGATATAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-797s1c1
Sequence:CCGGGCGCATATTAAAGATCGCATACTCGAGTATGCGATCTTTAATATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032839.1-1873s1c1
Sequence:CCGGCCAGTGCTAAACTACTGATTACTCGAGTAATCAGTAGTTTAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032839
VALIDATED
DIRC2 MISSION shRNA shRNA Plasmid DNA
disrupted in renal carcinoma 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-846s21c1
Sequence:CCGGTTGGAGTTGTCTGCTTAATATCTCGAGATATTAAGCAGACAACTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1558s21c1
Sequence:CCGGTGTGGTTGTCTCCGTTTAATACTCGAGTATTAAACGGAGACAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1841s21c1
Sequence:CCGGATAAAGCACTACCTAAGTAATCTCGAGATTACTTAGGTAGTGCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1979s21c1
Sequence:CCGGGATATGCCACTAACTTCTAAACTCGAGTTTAGAAGTTAGTGGCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1522s21c1
Sequence:CCGGGTGCTTCAGGGAATCCTATGACTCGAGTCATAGGATTCCCTGAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-2004s21c1
Sequence:CCGGTTCAAACCCTGTATCCAATTTCTCGAGAAATTGGATACAGGGTTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1318s21c1
Sequence:CCGGGAATAGCAGCGTGCCTATATTCTCGAGAATATAGGCACGCTGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-941s1c1
Sequence:CCGGCGGAGAAGCGTTTGTAGATTACTCGAGTAATCTACAAACGCTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-1001s1c1
Sequence:CCGGGCCATACCACTTGGTGTATTTCTCGAGAAATACACCAAGTGGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-537s1c1
Sequence:CCGGGCATACCTATATCAGACTTAACTCGAGTTAAGTCTGATATAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-797s1c1
Sequence:CCGGGCGCATATTAAAGATCGCATACTCGAGTATGCGATCTTTAATATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032839.1-1873s1c1
Sequence:CCGGCCAGTGCTAAACTACTGATTACTCGAGTAATCAGTAGTTTAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032839
VALIDATED
DIRC2 MISSION shRNA Lentiviral Transduction Particles
disrupted in renal carcinoma 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-846s21c1
Sequence:CCGGTTGGAGTTGTCTGCTTAATATCTCGAGATATTAAGCAGACAACTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1558s21c1
Sequence:CCGGTGTGGTTGTCTCCGTTTAATACTCGAGTATTAAACGGAGACAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1841s21c1
Sequence:CCGGATAAAGCACTACCTAAGTAATCTCGAGATTACTTAGGTAGTGCTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-1979s21c1
Sequence:CCGGGATATGCCACTAACTTCTAAACTCGAGTTTAGAAGTTAGTGGCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1522s21c1
Sequence:CCGGGTGCTTCAGGGAATCCTATGACTCGAGTCATAGGATTCCCTGAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032839.2-2004s21c1
Sequence:CCGGTTCAAACCCTGTATCCAATTTCTCGAGAAATTGGATACAGGGTTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032839.2-1318s21c1
Sequence:CCGGGAATAGCAGCGTGCCTATATTCTCGAGAATATAGGCACGCTGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-941s1c1
Sequence:CCGGCGGAGAAGCGTTTGTAGATTACTCGAGTAATCTACAAACGCTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032839.1-1001s1c1
Sequence:CCGGGCCATACCACTTGGTGTATTTCTCGAGAAATACACCAAGTGGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-537s1c1
Sequence:CCGGGCATACCTATATCAGACTTAACTCGAGTTAAGTCTGATATAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032839.1-797s1c1
Sequence:CCGGGCGCATATTAAAGATCGCATACTCGAGTATGCGATCTTTAATATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032839.1-1873s1c1
Sequence:CCGGCCAGTGCTAAACTACTGATTACTCGAGTAATCAGTAGTTTAGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153550
VALIDATED
DIRC2 MISSION shRNA Bacterial Glycerol Stock
disrupted in renal carcinoma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1946s1c1
Sequence:CCGGGCCGCTAACTTCTGAAGACATCTCGAGATGTCTTCAGAAGTTAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-802s1c1
Sequence:CCGGGACCGTGTTGTATGCAGAATTCTCGAGAATTCTGCATACAACACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-666s1c1
Sequence:CCGGCAATCGCATCAATGCTGAGTTCTCGAGAACTCAGCATTGATGCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-794s1c1
Sequence:CCGGCGAATCGAGACCGTGTTGTATCTCGAGATACAACACGGTCTCGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1219s1c1
Sequence:CCGGCCTAAACAGCATCACCCACTTCTCGAGAAGTGGGTGATGCTGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153550
VALIDATED
DIRC2 MISSION shRNA shRNA Plasmid DNA
disrupted in renal carcinoma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1946s1c1
Sequence:CCGGGCCGCTAACTTCTGAAGACATCTCGAGATGTCTTCAGAAGTTAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-802s1c1
Sequence:CCGGGACCGTGTTGTATGCAGAATTCTCGAGAATTCTGCATACAACACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-666s1c1
Sequence:CCGGCAATCGCATCAATGCTGAGTTCTCGAGAACTCAGCATTGATGCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-794s1c1
Sequence:CCGGCGAATCGAGACCGTGTTGTATCTCGAGATACAACACGGTCTCGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1219s1c1
Sequence:CCGGCCTAAACAGCATCACCCACTTCTCGAGAAGTGGGTGATGCTGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153550
VALIDATED
DIRC2 MISSION shRNA Lentiviral Transduction Particles
disrupted in renal carcinoma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1946s1c1
Sequence:CCGGGCCGCTAACTTCTGAAGACATCTCGAGATGTCTTCAGAAGTTAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-802s1c1
Sequence:CCGGGACCGTGTTGTATGCAGAATTCTCGAGAATTCTGCATACAACACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-666s1c1
Sequence:CCGGCAATCGCATCAATGCTGAGTTCTCGAGAACTCAGCATTGATGCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-794s1c1
Sequence:CCGGCGAATCGAGACCGTGTTGTATCTCGAGATACAACACGGTCTCGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153550.2-1219s1c1
Sequence:CCGGCCTAAACAGCATCACCCACTTCTCGAGAAGTGGGTGATGCTGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)