EMAIL THIS PAGE TO A FRIEND

DIS3

DIS3 mitotic control homolog (S. cerevisiae)

75 Gene Product Result for
Synonyms: EXOSC11 KIAA1008 RP11-342J4.3 RRP44 bA555G22.1 dis3p
Gene ID:
Mouse(72662) DIS3 mitotic control homolog (S. cerevisiae)
Rat(306103) DIS3 mitotic control homolog (S. cerevisiae)
sheep(101122118) DIS3 mitotic control homolog (S. cerevisiae)
Domestic Rabbit(100348230) DIS3 mitotic control homolog (S. cerevisiae)
domestic guinea pig(100731233) DIS3 mitotic control homolog (S. cerevisiae)
naked mole-rat(101723210) DIS3 mitotic control homolog (S. cerevisiae)
Zebrafish(100003553) DIS3 mitotic control homolog (S. cerevisiae)
cow(767887) DIS3 mitotic control homolog (S. cerevisiae)
Horse(100051938) DIS3 mitotic control homolog (S. cerevisiae)
domestic cat(101082118) DIS3 mitotic control homolog (S. cerevisiae)
dog(485491) DIS3 mitotic control homolog (S. cerevisiae)
chicken(418821) DIS3 mitotic control homolog (S. cerevisiae)
fruit fly(42900) CG6413 gene product from transcript CG6413-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101326 Anti-DIS3 (106-120) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1101327 Anti-DIS3 (401-415) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1401576 Anti-DIS3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2100585 Anti-DIS3 antibody produced in rabbit affinity isolated antibody canine, mouse, horse, bovine, human, guinea pig, rat, rabbit
western blot pricing
HPA039281 Anti-DIS3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4200402 Anti-DIS3 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
HPA058762 Anti-DIS3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4200474 Monoclonal Anti-DIS3 antibody produced in mouse ~1.0 mg/mL, clone DIS3-3, purified immunoglobulin human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4200505 Monoclonal Anti-DIS3 antibody produced in mouse ~1.0 mg/mL, clone DIS3-N, purified immunoglobulin rat, mouse, human
immunofluorescence, western blot pricing
SAB1403117 Monoclonal Anti-KIAA1008 antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014953 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093901 MISSION® esiRNA esiRNA human DIS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128226 Rosetta Predictions human pricing
NM_014953 Rosetta Predictions human pricing
NM_001127483 Rosetta Predictions rat pricing
NM_028315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330976 predicted 1902
2 SASI_Hs02_00330977 predicted 3213
3 SASI_Hs02_00330978 predicted 1896
4 SASI_Hs02_00330979 predicted 1865
5 SASI_Hs02_00330980 predicted 1381
6 SASI_Hs02_00330981 predicted 2882
7 SASI_Hs02_00330982 predicted 1725
8 SASI_Hs02_00330983 predicted 785
9 SASI_Hs02_00330984 predicted 1750
10 SASI_Hs02_00330985 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215137 predicted 1649
2 SASI_Hs01_00215139 predicted 2968
3 SASI_Hs01_00215140 predicted 1648
4 SASI_Hs01_00215141 predicted 242
5 SASI_Hs01_00215142 predicted 1131
6 SASI_Hs01_00215143 predicted 2636
7 SASI_Hs01_00215144 predicted 1480
8 SASI_Hs01_00215145 predicted 534
9 SASI_Hs01_00215146 predicted 1503
10 SASI_Hs02_00346632 predicted 364
11 SASI_Hs01_00215138 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253833 predicted 294
2 SASI_Rn02_00253834 predicted 2393
3 SASI_Rn02_00253835 predicted 1065
4 SASI_Rn02_00253836 predicted 405
5 SASI_Rn02_00253837 predicted 657
6 SASI_Rn02_00253838 predicted 1680
7 SASI_Rn02_00253839 predicted 1177
8 SASI_Rn02_00253840 predicted 2312
9 SASI_Rn02_00253841 predicted 2441
10 SASI_Rn02_00253842 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036837 predicted 698
2 SASI_Mm02_00333675 predicted 2455
3 SASI_Mm02_00333676 predicted 2672
4 SASI_Mm01_00036839 predicted 1881
5 SASI_Mm02_00333677 predicted 3024
6 SASI_Mm01_00036840 predicted 1896
7 SASI_Mm01_00036841 predicted 1188
8 SASI_Mm02_00333678 predicted 2793
9 SASI_Mm01_00036844 predicted 462
10 SASI_Mm02_00333679 predicted 2448
11 SASI_Mm01_00036838 predicted 1051
12 SASI_Mm01_00036842 predicted 684
13 SASI_Mm01_00036843 predicted 661
14 SASI_Mm01_00036845 predicted 1156
15 SASI_Mm01_00036846 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028315
VALIDATED
DIS3 MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1780s1c1
Sequence:CCGGGCGGCTATGAATGATGATATTCTCGAGAATATCATCATTCATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1620s1c1
Sequence:CCGGCGTTGGATCAAGAATCTGCAACTCGAGTTGCAGATTCTTGATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-695s1c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1241s1c1
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1253s1c1
Sequence:CCGGCGGAGAATTATTGTCGCTATTCTCGAGAATAGCGACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028315.2-3244s21c1
Sequence:CCGGCATAGAAGAGCCGATTAATATCTCGAGATATTAATCGGCTCTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2633s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2298s21c1
Sequence:CCGGCATACCTGAATACTCTATTAACTCGAGTTAATAGAGTATTCAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-1271s21c2
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-725s21c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028315
VALIDATED
DIS3 MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1780s1c1
Sequence:CCGGGCGGCTATGAATGATGATATTCTCGAGAATATCATCATTCATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1620s1c1
Sequence:CCGGCGTTGGATCAAGAATCTGCAACTCGAGTTGCAGATTCTTGATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-695s1c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1241s1c1
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1253s1c1
Sequence:CCGGCGGAGAATTATTGTCGCTATTCTCGAGAATAGCGACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028315.2-3244s21c1
Sequence:CCGGCATAGAAGAGCCGATTAATATCTCGAGATATTAATCGGCTCTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2633s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2298s21c1
Sequence:CCGGCATACCTGAATACTCTATTAACTCGAGTTAATAGAGTATTCAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-1271s21c2
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-725s21c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028315
VALIDATED
DIS3 MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1780s1c1
Sequence:CCGGGCGGCTATGAATGATGATATTCTCGAGAATATCATCATTCATAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028315.1-1620s1c1
Sequence:CCGGCGTTGGATCAAGAATCTGCAACTCGAGTTGCAGATTCTTGATCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-695s1c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1241s1c1
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028315.1-1253s1c1
Sequence:CCGGCGGAGAATTATTGTCGCTATTCTCGAGAATAGCGACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339737    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028315.2-3244s21c1
Sequence:CCGGCATAGAAGAGCCGATTAATATCTCGAGATATTAATCGGCTCTTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2633s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028315.2-2298s21c1
Sequence:CCGGCATACCTGAATACTCTATTAACTCGAGTTAATAGAGTATTCAGGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-1271s21c2
Sequence:CCGGGCGTTAGAAGGACGGAGAATTCTCGAGAATTCTCCGTCCTTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028315.2-725s21c1
Sequence:CCGGCGTCTTGCTTACTTGTCCGATCTCGAGATCGGACAAGTAAGCAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014953
VALIDATED
DIS3 MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014953.2-1222s1c1
Sequence:CCGGCGGAGAATTATTGTTGCTATTCTCGAGAATAGCAACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-282s1c1
Sequence:CCGGCCCTGCCATCAGGAATGTAATCTCGAGATTACATTCCTGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-649s1c1
Sequence:CCGGCCCGAACTCATAGATCGTCTTCTCGAGAAGACGATCTATGAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014953.2-2340s1c1
Sequence:CCGGGTCTCCAATATACACACATTTCTCGAGAAATGTGTGTATATTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-1473s1c1
Sequence:CCGGCCCACCAGGATGTACTGATATCTCGAGATATCAGTACATCCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-3014s21c1
Sequence:GTACCGGACCAAACCCACAGCTTATTTACTCGAGTAAATAAGCTGTGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014953.3-5188s21c1
Sequence:CCGGACGGGATCATCATCGTATATTCTCGAGAATATACGATGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2945s21c1
Sequence:CCGGGAATGCCATTGTGGTATTAATCTCGAGATTAATACCACAATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2910s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-698s21c1
Sequence:CCGGCATCCGAGATGTGACTAATAACTCGAGTTATTAGTCACATCTCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014953
VALIDATED
DIS3 MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014953.2-1222s1c1
Sequence:CCGGCGGAGAATTATTGTTGCTATTCTCGAGAATAGCAACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-282s1c1
Sequence:CCGGCCCTGCCATCAGGAATGTAATCTCGAGATTACATTCCTGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-649s1c1
Sequence:CCGGCCCGAACTCATAGATCGTCTTCTCGAGAAGACGATCTATGAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014953.2-2340s1c1
Sequence:CCGGGTCTCCAATATACACACATTTCTCGAGAAATGTGTGTATATTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-1473s1c1
Sequence:CCGGCCCACCAGGATGTACTGATATCTCGAGATATCAGTACATCCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-3014s21c1
Sequence:GTACCGGACCAAACCCACAGCTTATTTACTCGAGTAAATAAGCTGTGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014953.3-5188s21c1
Sequence:CCGGACGGGATCATCATCGTATATTCTCGAGAATATACGATGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2945s21c1
Sequence:CCGGGAATGCCATTGTGGTATTAATCTCGAGATTAATACCACAATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2910s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-698s21c1
Sequence:CCGGCATCCGAGATGTGACTAATAACTCGAGTTATTAGTCACATCTCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014953
VALIDATED
DIS3 MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014953.2-1222s1c1
Sequence:CCGGCGGAGAATTATTGTTGCTATTCTCGAGAATAGCAACAATAATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-282s1c1
Sequence:CCGGCCCTGCCATCAGGAATGTAATCTCGAGATTACATTCCTGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-649s1c1
Sequence:CCGGCCCGAACTCATAGATCGTCTTCTCGAGAAGACGATCTATGAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014953.2-2340s1c1
Sequence:CCGGGTCTCCAATATACACACATTTCTCGAGAAATGTGTGTATATTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014953.2-1473s1c1
Sequence:CCGGCCCACCAGGATGTACTGATATCTCGAGATATCAGTACATCCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-3014s21c1
Sequence:GTACCGGACCAAACCCACAGCTTATTTACTCGAGTAAATAAGCTGTGGGTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014953.3-5188s21c1
Sequence:CCGGACGGGATCATCATCGTATATTCTCGAGAATATACGATGATGATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2945s21c1
Sequence:CCGGGAATGCCATTGTGGTATTAATCTCGAGATTAATACCACAATGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-2910s21c1
Sequence:CCGGGTAAGTGAAGAAGCCTATATTCTCGAGAATATAGGCTTCTTCACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014953.3-698s21c1
Sequence:CCGGCATCCGAGATGTGACTAATAACTCGAGTTATTAGTCACATCTCGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks