EMAIL THIS PAGE TO A FRIEND

DIS3L2

DIS3 mitotic control homolog (S. cerevisiae)-like 2

55 Gene Product Result for
Synonyms: FAM6A PRLMNS hDIS3L2
Gene ID:
Human(129563) Summary: The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Mouse(208718) DIS3 mitotic control homolog (S. cerevisiae)-like 2
Rat(367307) DIS3 mitotic control homolog (S. cerevisiae)-like 2
sheep(101108891) DIS3 mitotic control homolog (S. cerevisiae)-like 2
Domestic Rabbit(100344728) DIS3 mitotic control homolog (S. cerevisiae)-like 2
domestic guinea pig(100725226) DIS3 mitotic control homolog (S. cerevisiae)-like 2
naked mole-rat(101704331) DIS3 mitotic control homolog (S. cerevisiae)-like 2
chicken(424934) DIS3 mitotic control homolog (S. cerevisiae)-like 2
cow(519222) DIS3 mitotic control homolog (S. cerevisiae)-like 2
Horse(100064500) DIS3 mitotic control homolog (S. cerevisiae)-like 2
domestic cat(101098075) DIS3 mitotic control homolog (S. cerevisiae)-like 2
dog(610194) DIS3 mitotic control homolog (S. cerevisiae)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152383 Rosetta Predictions human pricing
NM_001109007 Rosetta Predictions rat pricing
NM_153530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161679 predicted 760
2 SASI_Hs02_00366045 predicted 635
3 SASI_Hs02_00366046 predicted 2473
4 SASI_Hs02_00366047 predicted 2432
5 SASI_Hs01_00161680 predicted 473
6 SASI_Hs01_00161682 predicted 845
7 SASI_Hs01_00161684 predicted 1491
8 SASI_Hs01_00161685 predicted 1374
9 SASI_Hs01_00161686 predicted 1023
10 SASI_Hs01_00161687 predicted 1874
11 SASI_Hs01_00161681 predicted 865
12 SASI_Hs01_00161683 predicted 877
13 SASI_Hs01_00161688 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244254 predicted 928
2 SASI_Rn02_00244255 predicted 2571
3 SASI_Rn02_00244256 predicted 927
4 SASI_Rn02_00244257 predicted 2283
5 SASI_Rn02_00244258 predicted 1896
6 SASI_Rn02_00244259 predicted 1092
7 SASI_Rn02_00244260 predicted 2605
8 SASI_Rn02_00244261 predicted 917
9 SASI_Rn02_00244262 predicted 834
10 SASI_Rn02_00244263 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097937 predicted 729
2 SASI_Mm01_00097938 predicted 322
3 SASI_Mm01_00097939 predicted 984
4 SASI_Mm01_00097940 predicted 678
5 SASI_Mm01_00097941 predicted 2175
6 SASI_Mm01_00097942 predicted 608
7 SASI_Mm01_00097943 predicted 643
8 SASI_Mm01_00097944 predicted 1115
9 SASI_Mm01_00097945 predicted 617
10 SASI_Mm02_00343294 predicted 303
11 SASI_Mm01_00097946 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153530
DIS3L2 MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-426s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-501s1c1
Sequence:CCGGCCAGAGAGCAATGACAAAGAACTCGAGTTCTTTGTCATTGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-992s1c1
Sequence:CCGGCCGACCTAAAGACTTTGCCAACTCGAGTTGGCAAAGTCTTTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-1533s1c1
Sequence:CCGGCCTGAAGGCAAGATCCTTGAACTCGAGTTCAAGGATCTTGCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-425s1c1
Sequence:CCGGTGCTCGTAATAGAGCCTTAAACTCGAGTTTAAGGCTCTATTACGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153530
DIS3L2 MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-426s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-501s1c1
Sequence:CCGGCCAGAGAGCAATGACAAAGAACTCGAGTTCTTTGTCATTGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-992s1c1
Sequence:CCGGCCGACCTAAAGACTTTGCCAACTCGAGTTGGCAAAGTCTTTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-1533s1c1
Sequence:CCGGCCTGAAGGCAAGATCCTTGAACTCGAGTTCAAGGATCTTGCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-425s1c1
Sequence:CCGGTGCTCGTAATAGAGCCTTAAACTCGAGTTTAAGGCTCTATTACGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153530
DIS3L2 MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-426s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-501s1c1
Sequence:CCGGCCAGAGAGCAATGACAAAGAACTCGAGTTCTTTGTCATTGCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-992s1c1
Sequence:CCGGCCGACCTAAAGACTTTGCCAACTCGAGTTGGCAAAGTCTTTAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-1533s1c1
Sequence:CCGGCCTGAAGGCAAGATCCTTGAACTCGAGTTCAAGGATCTTGCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153530.1-425s1c1
Sequence:CCGGTGCTCGTAATAGAGCCTTAAACTCGAGTTTAAGGCTCTATTACGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152383
DIS3L2 MISSION shRNA Bacterial Glycerol Stock
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-438s1c1
Sequence:CCGGCGGATGGTGATCGAGACATTTCTCGAGAAATGTCTCGATCACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1874s1c1
Sequence:CCGGCCTCAAGGATGTCATATCTATCTCGAGATAGATATGACATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152383.2-2037s1c1
Sequence:CCGGCCAAACATTTGGAGATGACAACTCGAGTTGTCATCTCCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1175s1c1
Sequence:CCGGGAAGGAATACTAACAGAGTATCTCGAGATACTCTGTTAGTATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-382s1c1
Sequence:CCGGCCAGGGTGTATTGAGAATTAACTCGAGTTAATTCTCAATACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-383s1c1
Sequence:CCGGCAGGGTGTATTGAGAATTAATCTCGAGATTAATTCTCAATACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-476s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-925s1c1
Sequence:CCGGCCTCAAACTCTTGGCTGATAACTCGAGTTATCAGCCAAGAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-1759s1c1
Sequence:CCGGCGTCTTGAATCTCCACGGAATCTCGAGATTCCGTGGAGATTCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152383
DIS3L2 MISSION shRNA shRNA Plasmid DNA
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-438s1c1
Sequence:CCGGCGGATGGTGATCGAGACATTTCTCGAGAAATGTCTCGATCACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1874s1c1
Sequence:CCGGCCTCAAGGATGTCATATCTATCTCGAGATAGATATGACATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152383.2-2037s1c1
Sequence:CCGGCCAAACATTTGGAGATGACAACTCGAGTTGTCATCTCCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1175s1c1
Sequence:CCGGGAAGGAATACTAACAGAGTATCTCGAGATACTCTGTTAGTATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-382s1c1
Sequence:CCGGCCAGGGTGTATTGAGAATTAACTCGAGTTAATTCTCAATACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-383s1c1
Sequence:CCGGCAGGGTGTATTGAGAATTAATCTCGAGATTAATTCTCAATACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-476s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-925s1c1
Sequence:CCGGCCTCAAACTCTTGGCTGATAACTCGAGTTATCAGCCAAGAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-1759s1c1
Sequence:CCGGCGTCTTGAATCTCCACGGAATCTCGAGATTCCGTGGAGATTCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152383
DIS3L2 MISSION shRNA Lentiviral Transduction Particles
DIS3 mitotic control homolog (S. cerevisiae)-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-438s1c1
Sequence:CCGGCGGATGGTGATCGAGACATTTCTCGAGAAATGTCTCGATCACCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1874s1c1
Sequence:CCGGCCTCAAGGATGTCATATCTATCTCGAGATAGATATGACATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152383.2-2037s1c1
Sequence:CCGGCCAAACATTTGGAGATGACAACTCGAGTTGTCATCTCCAAATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-1175s1c1
Sequence:CCGGGAAGGAATACTAACAGAGTATCTCGAGATACTCTGTTAGTATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-382s1c1
Sequence:CCGGCCAGGGTGTATTGAGAATTAACTCGAGTTAATTCTCAATACACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-383s1c1
Sequence:CCGGCAGGGTGTATTGAGAATTAATCTCGAGATTAATTCTCAATACACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152383.2-476s1c1
Sequence:CCGGGCTCGTAATAGAGCCTTAAATCTCGAGATTTAAGGCTCTATTACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-925s1c1
Sequence:CCGGCCTCAAACTCTTGGCTGATAACTCGAGTTATCAGCCAAGAGTTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152383.2-1759s1c1
Sequence:CCGGCGTCTTGAATCTCCACGGAATCTCGAGATTCCGTGGAGATTCAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks